Tiny Viking

Frat boy vampire draining someone while his bros chant “CHUG CHUG CHUG” in the background

Mutuals this could be us

Opening up a boy with the cold ones

Please list your full genome sequence in your bio

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

never understood the whole showing up at your high school reunion revenge fantasy cause like really? high school?? I don’t want anyone from that time in my life to have any idea where I am or what I’m doing. do not perceive me I am dead to you and you are dead to me

mr darcy lived in derbyshire so he sounds like. lizzeh. ah lov yew moost ahhdentleh

wait the places in pride and prejudice are real?

england is indeed real

Crying

fucked up if true </3

early 00s media was the era of the boring girl protagonist and her heavily lesbian-coded bff

i was wondering what was wrong with this picture.... then I realized there was no blue filter

is anyone else like....... exhausted? just way too tired? mentally and physically? and you look at other people your age who seem to be doing fine and you feel so dysfunctional and broken because normal adult tasks and responsibilities just feel way too overwhelming and you can’t cope and

hey icarus bro wanna order some hot wings-oh my god im so fucking sorry dude

I laughed so hard I gave myself an actual headache oml

do you know how thrilled i was to realise this has audio and the audio is gorgeous???

Isn’t this a potential problem though? Can you run a malicious script in the namebox there? If so, they will most certainly have to fix that before they implement trading.

is it even possible to write a malicious script in html?

<hack>i’m in</hack>