kill the shift manager in your brain

you are not wasting time you are vibing. you are not being unproductive you are literally chilling. make a grill cheese with cheddar cheese and slather a piece of the bread with some honey and maybe you'll relax

What would happen if you got an email

i would check it

You sick fuck.

Me walking into work

i am going to dedicate my life to mastering the art of making the people around me feel seen and loved

Please list your full genome sequence in your bio

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

I be sleeping in the master chief position

I miss when library books used to have little paper pockets inside with a list of all the people who borrowed it and when... I hate that this is now exclusive knowledge of librarians. I do care that a miss Mariana borrowed this book in 1985 and then Dario in 1997. They're my brothers and sisters

had to stop playing 5d chess with multiverse time travel because my knights fell in love and kept going back in time to save each other in every timeline and creating paradoxical time loops and it was just this whole thing