sometimes i feel ive got to *minecraft death sound* *minecraft death sound* run away
Xuebing Du
Lint Roller? I Barely Know Her

shark vs the universe
🩵 avery cochrane 🩵
let's talk about Bridgerton tea, my ask is open
Sade Olutola
Cosimo Galluzzi
KIROKAZE
almost home
Cookie Run:Kingdom Official!

@theartofmadeline

blake kathryn
🪼
"I'm Dorothy Gale from Kansas"
One Nice Bug Per Day
cherry valley forever
Fai_Ryy
Cosmic Funnies

❣ Chile in a Photography ❣

pixel skylines
seen from United States
seen from United States

seen from Malaysia

seen from United States
seen from South Africa
seen from Saudi Arabia

seen from United States

seen from Pakistan

seen from United States
seen from Türkiye

seen from Côte d’Ivoire

seen from Brazil

seen from Australia
seen from Thailand
seen from Paraguay
seen from Israel

seen from United States

seen from Malaysia
seen from Ireland

seen from Ukraine
@barbiedollvevo
sometimes i feel ive got to *minecraft death sound* *minecraft death sound* run away

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Super Bowl Half Time Show:
I was so excited and then let down.
i speak french in public to my grandparents and to my boyfriend. people are surprised that im bilingual and say its cool and ask me to teach them some time
but when one of my classmates speaks arabic in public to her family, she gets strange and disgusted looks. no one asks to be taught arabic. no one says its cool that shes bilingual
its racism plain and simple
Finding out Bo Burnham is 6'5" and not like 5'11" has absolutely killed me today. The concept of some Goliath twink pacing around a stage yelling absurdities and throwing glitter is triggering my fight or flight response
I’m sorry HE’S WHAT NOW??

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
req’d by @katfuzz
this is fuckin pacifist route erasure bud
I senta humble prayer to a god and they responded, holy shit
i am just,,, a humble togetherslapper of words,,, not meant to be deified,,,
Too late, you are now The Oracle.
>:(
i dont wanna be the oracle
Is this because of your aversion to being the main character?
op is socrates
this has to be the most disgusting thing i’ve ever seen
when someone is physically attractive but boring as hell
movies : Ponyo On The Cliff By The Sea - Gake no Ue no Ponyo (崖の上のポニョ) | 2008
“I love Ponyo whether she’s a fish, a human, or something in between.”
Me to myself every time I try to socialize with new people:

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Cher destroying gender
my 2019 resolution is to live deliciously
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
Lucky is evolving past his image form

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Wine glass full of Mac and cheese garnished with two dinosaur chicken nuggets.