Ted Noten SuperBitch Bag, 2000 (Gun Casted in Acrylic, Snake-Skin Handle)
I know it’s the year it was made and not part of the title but i want it to be “SuperBitch Bag 2000”
The Stonewall Inn
Mike Driver

Kiana Khansmith
sheepfilms
★
Not today Justin
macklin celebrini has autism

ellievsbear
Cosmic Funnies
Lint Roller? I Barely Know Her

bliss lane
🩵 avery cochrane 🩵

shark vs the universe
I'd rather be in outer space 🛸
Sade Olutola
Show & Tell
Monterey Bay Aquarium
Game of Thrones Daily

PR's Tumblrdome
tumblr dot com

seen from United States
seen from United States

seen from United States

seen from United States

seen from United States

seen from Chile

seen from Canada

seen from United States
seen from Canada

seen from Czechia

seen from Germany
seen from United States

seen from Türkiye
seen from Uruguay

seen from United Kingdom

seen from United Kingdom

seen from United States

seen from Singapore

seen from United States

seen from Bangladesh
@thatdamntree
Ted Noten SuperBitch Bag, 2000 (Gun Casted in Acrylic, Snake-Skin Handle)
I know it’s the year it was made and not part of the title but i want it to be “SuperBitch Bag 2000”

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
dad bod spiderman can’t drive
well MAYBE he can, but he’s a miserable parallel parker
It’s the 10 year anniversary of 2009…
we let fireflies be a hit the same year tik tok dropped what the fuck
theres no way all these songs came in 2009 i straight up refuse to believe this im sucking the video back out of my head

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
The fact that the location of the world’s oldest tree has to be kept secret encapsulates everything that’s bad about humanity.
There’s a story about that, actually.
According to the smithsonianmag.com, the world’s oldest bristlecone pine was a nearly 5,000 year old tree later named Prometheus. In 1964, a man named Donald Rusk Currey decided to use an increment borer to determine its age (a process that cuts a small hole into the center of the tree trunk, and is not intended to kill the tree). Unfortunately, the borer got stuck. He and a park ranger cut the tree down to remove the equipment, and when they counted the tree rings, they realized their mistake. Oops. This incident lead to better protection of the remaining bristlecone pines.
There’s some wiggle room about what can be called “the world’s oldest living tree.” The world’s oldest living single tree is the tree that the OP is referring to. Its name is Methuselah,and it is also around 5,000 years old. Since its location is unknown, nobody knows what it looks like. But it might be this tree here:
But technically, it isn’t the oldest living tree. Let me explain.
It turns out that root systems of trees can send up genetically identical saplings (aka clones) via their root systems. Like so:
Which means the original trunk can die, but since the root system is attached to other trees which give it nutrients, it lives on. The root system can theoretically do this indefinitely. So the tree trunks could be fairly young, but the roots could be large and very, very, very old. So the oldest “tree” isn’t a small grove, it’s a logic-defying forest.
I’d like you to meet Pando.
This male quaking aspen covers 106 acres and is ancient. I’m talking an estimate of 80,000 years. The trees you can see are just “shoots” he sent up, and their average age is 130 years old. He is his own forest. If trees could talk, I’d love to hear what he had to say.
He might be dying, due to insects and drought (hmm, wonder what could have happened to cause that). A section of Pando is being studied in an attempt to find a solution. But in the meantime, we can enjoy him for his beauty.
TLDR: Yes please, protect the trees from humans!
The Gidmit’en Clan, whose members are at the second check point, have called any RCMP raid an “act of war.”
The RCMP are setting up exclusion zones and closed roads to the public and media as officers get set to dismantle two camps on unceded Wet’suwet’en territory.
“During the police enforcement operation, temporary exclusion zones and road closures will be established for police and public safety reasons,” said the news release sent out Monday morning that confirmed the RCMP will enforce a court order requested by a pipeline company trying to build a pipeline through Wet’suwet’en territory.
“Those areas will be clearly marked and media/public are welcome to stand at the perimeter, but no one will be allowed to enter the exclusion zones. These zones will only be maintained as long as necessary.”
See full statement here: What to expect during the police enforcement of court ordered injunction in Houston, BC
The raids have been highly anticipated after a B.C. judge granted an interim injunction in December against two check points leading to the construction site for the LNG Coastal GasLink pipeline.
Continue Reading.
you know, that whole thing when a colonist militaristic police force storms a indigenous encampment, removes it’s people who live there, all for corporate interest, so we can pump more oil out, and accelerate the death of the planet. Then once the Cops storm the place, they declare an “exclusion zone” deploy a wifi and cell blockage, AND exclude media. All so no news of it gets out. You all need to be fucking outraged. We live in a police state, and the moment your life gets in the way of making money, you cease to matter.
Hey Americans, you know how we Canadians all shared information about Standing Rock as it was happening?
We’re having a very similar situation in Canada right now.
Now would be a good time to reciprocate.
This is happening RIGHT NOW.
Nobody on this site besides me and a few other bloggers are talking about this.
Like there are only 2 or 3 blogs in total in the #Wet’suwet’en or #Unist’ot’en or Unist’ot’en Camp hashtags from the past week.
That’s not a cursed image
Chess v2.001 Patch Notes
- Fuck pawns knights bishops and kings
- Rooks go hog wild
kirby stack!
@ all the big sonic fans out there im so sorry

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
please unmute
UNMUTE
Do it
secret..,.,,.,
meirl
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
I felt now was a good time for the memes-of-the-year recap:
OH MY GOD
what a year

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
w
what the fuck does this mean
signal boost i need the world to know the tumblr app called me a dick snatch on december 7th, 2016
it called you a dick snatch because that’s what you tell siri to call you…
Dick Snatch: Exposed
dick: snatched
Top It Off