HOT WIZARDS IN YOUR AREA!!
tumblr dot com

❣ Chile in a Photography ❣
will byers stan first human second
official daine visual archive

@theartofmadeline
NASA
occasionally subtle
The Bowery Presents

oozey mess
Cosimo Galluzzi
Game of Thrones Daily

gracie abrams
One Nice Bug Per Day
he wasn't even looking at me and he found me
𓃗
🩵 avery cochrane 🩵
Aqua Utopia|海の底で記憶を紡ぐ
hello vonnie
seen from Kazakhstan

seen from Australia
seen from United Kingdom

seen from Ecuador
seen from United States
seen from Poland
seen from Egypt

seen from United Kingdom

seen from Austria

seen from Dominican Republic
seen from Jordan

seen from France

seen from Türkiye

seen from Singapore
seen from China
seen from Romania
seen from Malaysia

seen from United Kingdom
seen from T1
seen from Egypt
@yet-another-wizard-detector
HOT WIZARDS IN YOUR AREA!!

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
hey guys is there a nice wizard on tumblr or is it only the evil one
it’s just me
Wizard detected.....
Yeah man, this wizard sleepover is cozy. I just saw a guy gently clap his hands together and say "hot beverage conjuration" or something, and suddenly everyone was holding a perfect mug of their favorite warm drink in their hands. Nobody who was already sleeping even woke up, that's how cozy it is. I'm over here casting pillow and level 2 pyjamas. I think I just heard "power word: blanket fort" two groups over. I gotta get in there.
Wizard detected.
me when my nefarious schemes are all coming together
The orb detected.
things that feel like a microaggression
they really said "dye is expensive this year"
Seems like a good time to bring this up again:
Ever wondered why there aren’t more fuchsia cars? The prejudice against bright colors runs deep and can be traced back to the age of Western

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
come back my scarab
please come back my scarab
i,m so fuckign sorryy my scarab
NO WIZARDS DETECTED.
the most powerful wizard in the aquarium summons his dinner
Wizard detected.
fuck 4chan
fuck twitter
fuck reddit
fuck tumblr
and fuck you
Wizard detected.
Shit man, this wizard cold war is fucked. I just saw the president clap his hands together and say "Duplicate them bish" or some similar shit, and now there are two middle east's and russia is twice as big. The camera didn't even go onto him, that's how common shit like this is. My ass casted heal community and now my neighbor is talking with the FBI becouse they think I am some sort of wizard commie. I think I just heard "power word:MKULTRA" two groups over. I gotta get the fuck outta here man.
WIZARD DETECTED.
knights can be created by other knights like vampires except instead of biting them they wack them on the shoulders with swords
the honey they produce is chivalrous deeds
DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights. Before that, any guy with a sword and a horse could just be a knight. Just because the monarchy is holding all the knight rights in England doesn’t mean that is the way it is supposed to be. Knight anarchy.
🗡️ If you’re reading this, I have knighted you. Fuck all those chivalric orders that popped up during the Crusades. Knight anarchy. 🗡️
DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights.
dragons
DRAGONS LOCATED
NO WIZARDS DETECTED.
( hello friend! )
...Do I know you?
NO WIZARDS DETECTED.
( not in the least )

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
WIZARD DETECTED.
knights can be created by other knights like vampires except instead of biting them they wack them on the shoulders with swords
the honey they produce is chivalrous deeds
DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights. Before that, any guy with a sword and a horse could just be a knight. Just because the monarchy is holding all the knight rights in England doesn’t mean that is the way it is supposed to be. Knight anarchy.
🗡️ If you’re reading this, I have knighted you. Fuck all those chivalric orders that popped up during the Crusades. Knight anarchy. 🗡️
DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights.
dragons
DRAGONS LOCATED
NO WIZARDS DETECTED.
( hello friend! )
You know with the officalverse making it's way off Tumblr (ao3, unfortunately c.ai, and I think I heard people mention Pinterest?) it's got me wondering how long until we reach YouTube shorts/Tiktoc. Or long form YouTube accounts that read Tumblr stuff. Can't wait for the hour+ long video essay on the officalverse to drop lmao
3k likes and I'll make an hour+ long deepdive of the officalverse /srs
guys we need to get it to 3k likes
Seeing a video essay on us would be sick /piss
SUMMONED
Detectors summoning detected
@gimmick-thief
@rat-detector-seven @axolotl-decider @axolotl-2 @fork-detector @girl-detector @bat-detector @i-am-a-fish @peel-this-off @meri-is-best-axolotl @rocktis @erectile-disgruntlement @yet-another-wizard-detector @ixnova @i-love-dragonss @oreozfox @owostrich @protogen6768 @xx-obliviousfantasy-xx @void-things @miku-detector @crane-detector @crab-detector @bear-detector @orca-detector @crowifier-the-crowverlord @corvid-detector @corviddetector @columbiforme-detector @curse-of-10k
NO WIZARDS DETECTED!
Photographer says that’s a fisherman, but I know a wizard when I see one.
Catches fish with water magic
“I know a wizard when I see one” is a perfect summary of the aesthetic I hope to achieve someday.
his cormorant familiars actually do the fishing for him. Like legitimately, that’s what they’re for
Respect the tradition
WIZARD DETECTED.
“hi welcome to mcdonalds what can i get for you?”
“yeah can i get a deluxe quarter pounder with cheese?”
“absolutely, do you want the meal or just the sandwich?’
“uuuuuh hold on”
*fishes something out of my pocket*
“mikey what do i do?”
“get the fries. youll need the energy in the coming days”
*stuffs it back in my pocket*
“uhh yes please the meal would be great”
String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagat
Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl
(image source)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Wizard not detected.
BONUS: ORB DETECTED
Okay I've killed fifty of you fuckers, hopefully this one will be normal
Sorry I don't think I am 😔
WIZARD DETECTED.