shark vs the universe
almost home
Alisa U Zemlji Chuda
h
tannertan36
Misplaced Lens Cap
Cosimo Galluzzi
blake kathryn
2025 on Tumblr: Trends That Defined the Year
hello vonnie
ellievsbear
One Nice Bug Per Day
ojovivo
Aqua Utopiaļ½ęµ·ć®åŗć§čØę¶ćē“”ć
Janaina Medeiros
dirt enthusiast
Product Placement
seen from China
seen from United States
seen from Brazil
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from Malaysia
seen from United States
seen from United Kingdom
seen from Iraq
seen from United States
seen from Malaysia
seen from Mexico
seen from United States
seen from Poland
@sirdannir
Hi brain, you obstinate fucker. I drank the clear splashy stuff. I ate the green things. I went under that bright fucker up there. I did the thing with the moving and sweating and whatnot. Now make the happy chemical, you lump of fuck.
did you do the thing with lying unconscious for 8 hours
ā¦ā¦ā¦ fuck.
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ā¢ No registration required ā¢ HD streaming
:)Ā More Behind the GIFs.Ā
so that post about how you can get around the bot by tagging thingsĀ ā#sfwā? uhhhhh itās TRUE.
i did a little test in my drafts:
i am losing my goddamn mind like how is it possible to be this stupid
Fucking hell?!?!!??
[source]
FREE HIM
HE CAME BACK
Everything about this is so fucking funny. The song. The chubby dances. The way he just gets fucking KIDNAPPED. The presentation of the guy in the white shirt in the picture when he returns. This is my favorite post.
Are straight white people okay????
What is this?!
People like this exist. Interesting.
this story has a part 2
THERE IS A PART 3 WITH GUEST RESPONSES I REPEAT THERE IS A PART 3 THIS IS NOT A DRILL
I thought things couldnāt get more horrifyingly amusing than the woman who wanted people to pay $1000 each to go to her wedding so she could āfeel like a Kardashian for a dayā and had a Facebook breakdown about it saying she was gonna go backpacking in Peru to āfind herselfā after being ābetrayedā by her friends who didnāt want to partake but here we are
I thought it was the same person ngl.
Iām in the wedding shaming group and saw both this and the Peru post before it went viral. Love it.
THEREāS AN UPDATE
Stephanie is a true hero.
my favorite thing about this update is that the fact that we are even SEEING this means thereās AT LEAST one other snitch in the party that she hasnāt caught yet
My condolences to the groom.
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ā¢ No registration required ā¢ HD streaming
Did everyone justā¦. forget how to create, all of a sudden? Disney pumping out the fourth remake in a row? Movies are like 70% sequels? Stories in games being just bad if they exist at all? Havenāt had a book get hyped in like half a decade? Are we okay? Whatās going on?
Right now, the largest and most deadly wildfire in California history is burning. Last year, Hurricane Harvey drowned southeast Texas under punishing, endless rain; a month ago, Hurricane Florence ā¦
The myth that panic, looting, and antisocial behavior increases during the apocalypse (or apocalyptic-like scenarios) is in fact a mythāand has been solidly disproved by multiple scientific studies. The National Earthquake Hazards Reduction Program, a research group within the United States Federal Emergency Management Administration (FEMA), has produced research that shows over and over again that ādisaster victims are assisted first by others in the immediate vicinity and surrounding area and only later by official public safety personnel [ā¦] The spontaneous provision of assistance is facilitated by the fact that when crises occur, they take place in the context of ongoing community life and daily routinesāthat is, they affect not isolated individuals but rather people who are embedded in networks of social relationships.ā (Facing Hazards and Disasters: Understanding Human Dimensions, National Academy of Sciences, 2006). Humans do not, under the pressure of an emergency, socially collapse. Rather, they seem to display higher levels of social cohesion, despite what media or government agents might expectā¦or portray on TV. Humans, after the apocalypse, band together in collectives to help one anotherāand they do this spontaneously. Disaster response workers call it āspontaneous prosocial helping behaviorā, and it saves lives.
Iāve been sharing this article a lot recently! I think itās important
#stop believing capitalismās myths about human nature#and start remembering that we are the descendants of the first animals to bury their dead with flowers#we are all alive because of kindness. because of cooperation. because of companionship. because of mutual aid.#we did not become the dominant species based on rugged individualism: we survived together. and thatās the only way forward.Ā (via @robotmango)
The Thief
The Jester
The Fool
The King
Sneaky sneak~
Marinette getting in the December mood
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ā¢ No registration required ā¢ HD streaming
what th
IāVE BEEN TRYING TO find this again for THREE YEARS but once Free! came out I couldnāt google ANIME SWIMMING CLIP ANYMORE
This is such a god damn amazing piece of animation
Oh myfdb c
Incase anything happens to my account hereās my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGā¦
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
Iām a simple man
The Sugar Plum Fairy
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ā¢ No registration required ā¢ HD streaming
