Judge magazine, 1921
this has been a mood for nearly 100 years now
One more year before the 100year anniversary
it’s been 100 years now
happy centennial anniversary to a meme about looking shitty in photos 🥳 🍾

tannertan36
wallacepolsom
Aqua Utopia|海の底で記憶を紡ぐ

Discoholic 🪩

❣ Chile in a Photography ❣
Show & Tell
Three Goblin Art

Kiana Khansmith
untitled
I'd rather be in outer space 🛸

izzy's playlists!
Mike Driver
let's talk about Bridgerton tea, my ask is open
Claire Keane

if i look back, i am lost
Xuebing Du

Origami Around

PR's Tumblrdome

seen from Malaysia
seen from Hungary
seen from Argentina

seen from Portugal

seen from Singapore
seen from Czechia

seen from Japan
seen from Germany

seen from United States

seen from France

seen from United States
seen from Germany

seen from United States
seen from Argentina
seen from United States

seen from Malaysia
seen from France

seen from United States
seen from France
seen from France
@littlemasonjar
Judge magazine, 1921
this has been a mood for nearly 100 years now
One more year before the 100year anniversary
it’s been 100 years now
happy centennial anniversary to a meme about looking shitty in photos 🥳 🍾

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Back in the 1960s, the U.S. started vaccinating kids for measles. As expected, children stopped getting measles.
But something else happened.
Childhood deaths from all infectious diseases plummeted. Even deaths from diseases like pneumonia and diarrhea were cut by half.
“So it’s really been a mystery — why do children stop dying at such high rates from all these different infections following introduction of the measles vaccine,” says Michael Mina, a postdoc in biology at Princeton University and a medical student at Emory University.
Scientists Crack A 50-Year-Old Mystery About The Measles Vaccine Photo credit: Photofusion/UIG via Getty Images
Using computer models, they found that the number of measles cases in these countries predicted the number of deaths from other infections two to three years later.
“We found measles predisposes children to all other infectious diseases for up to a few years,” Mina says.
And the virus seems to do it in a sneaky way.
Like many viruses, measles is known to suppress the immune system for a few weeks after an infection. But previous studies in monkeys have suggested that measles takes this suppression to a whole new level: It erases immune protection to other diseases, Mina says.
VACCINATE. YOUR. DAMN. KIDS.
a rlly good trope is a teenager who was forced to grow up too fast suddenly being surrounded by teens who love having fun and goofing off, and just slowly starting to come out of their shell and do dumb stuff just for the hell of it bc they can finally act their age
#im thinking abt zuko and hnghgj #him and sokka are so funny #3 swords #2 teenage boys #1 brain cell
op why would you hide this vital content in the tags i’m

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
My name is Peter Parker. My universe is 1933, and I’m a private eye. I like to drink egg cream, and I fight Nazis. A lot.
Spider-Man: Into the Spider-Verse 2018, dir. Bob Persichetti & Peter Ramsey
ideal existence
Imagine never being late to anything
“what time is it?” *gets arrested*
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
This photo of my brother's cat trying to jump on the dinner table at Christmas feels like a Normal Rockwell painting.
He just wants to be included!!
(He's got an Insta btw).
This is so funny, please never spread it because my mother will kill me.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Leslie Strock - https://nokkiart.tumblr.com - https://www.lesliestrock.com - https://www.instagram.com/nokki1 - https://www.linkedin.com/in/leslie-strock-6b76a43a - https://www.patreon.com/lesliestrock - https://twitter.com/nokkinatter?lang=es - http://www.gallerynucleus.com/artist/leslie_strock - http://ctnanimationexpo.com/leslie-strock - https://www.etsy.com/market/leslie_strock - https://inkphy.com/user/nokki1/179479188
Heather Penn - http://happydorid.tumblr.com - https://twitter.com/heatpenn - https://www.kickstarter.com/projects/607081461/tea-spirits-2015-calendar - https://www.inprnt.com/gallery/happydorid - https://dribbble.com/fastbee - https://www.instagram.com/heatpenn
okay, who tf put this monolith in my toilet?

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Was there one [Princess] in particular that you were excited to meet?