is high jump kicking peoples dogs punk
no, to punk is to love
I love to high jump kick peoples dogs
won’t a high jump kick miss most dogs? they’re usually kinda low to the ground
whats not clicking
String identified: gcggtttgcgtagctgtaattgtcttaagataatcttaggtctgcgtcatataatattagaatataaggtcaattccg
Closest match: Aulonocara stuartgranti genome assembly, chromosome: 19 Common name: Flavescent Peacock
(image source)












