titsay
he wasn't even looking at me and he found me
Show & Tell
I'd rather be in outer space 🛸
Product Placement
$LAYYYTER
Game of Thrones Daily
Alisa U Zemlji Chuda
Sade Olutola
Love Begins
Stranger Things
dirt enthusiast
Three Goblin Art
will byers stan first human second
PUT YOUR BEARD IN MY MOUTH
tumblr dot com
blake kathryn
roma★
Xuebing Du
Monterey Bay Aquarium
seen from Switzerland
seen from Malaysia
seen from Paraguay
seen from Malaysia
seen from Netherlands
seen from Malaysia
seen from Paraguay
seen from Austria
seen from United States
seen from Nepal
seen from Malaysia
seen from Romania
seen from United States
seen from Jordan
seen from Singapore
seen from Oman
seen from Jordan
seen from Jordan
seen from United States
seen from United States
@penntem-blog
Some quick animation smear guides I put together for a friend! not sure if it works as a tutorial without my in person commentary, also more intended as a guide to show examples of basic/common smear types :O
…might make a tutorial on how to use smears another time…
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
friend: what are you doing?
me: im on tumblr
friend: whats your @?
me: sorry i dont have tumblr
just a thought
ok but one of my favorite writing “tropes” is when a character’s entire personality is based on their occupation/favorite subject or whatever. and like it’s literally all they talk about and stuff
It’s most prominent in Cartoons and stuff, but stuff like
“This is A. A likes Math. A’s favorite mobile game is calculator.”
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
something for fun!!
the cuil theory
jesus CHRIST
tHIS IS THE SINGLE MOST BRILLIANT THING I HAVE EVER HEARD I WAS IN HYSTERICS AT 2 CUIL
i find this hilarious considering The Cuil Theory was a popular meme back in 2012, with a similar format as a popular Welcome To Nightvale meme. “weird” posts would usually have an additional reblog with “and now, the weather” in reference to WTNV but for a few months, “weird’ posts would be ended with “i give you a hamburger”. the peak of the meme was around late october of 2012, the actual video itself being published february of 2012.
its a meme revival
And now… The weather.
Some other personal fav doodles,,, I draw cheesecake wayyy too much but I rlly love her and her whole aesthetic. Grapefruit n chili pepper r super rad tho and I love em They’re slightly more finished than some of my other stuff,, even tho my sketchbook paper can’t handle it
one mor e
Some more doodles!!! Some of these r super off model and unrecognizable,, and same face syndrome?? Oof
some more cookie run stuff,,,
Some more doodles!!! Some of these r super off model and unrecognizable,, and same face syndrome?? Oof
some stuff from a cookie run side account I’m an admin on
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
if youre lgbt and draw reblog and tag your biggest artist flaw
im bi and i cant fucking color to save my life
sorta decently sized art dump bc hhhhhhhhhhhhhhhhhhh it feels weird uploading closed species stuff even tho they’re like. characters I’m writing??
anyway
first adopt is by 11lamb @ da | 2nd image is just a werewolf | next 5 images are a closed species by umbral-wind on th who are my babies and I am Happy To Finally Own Them. | serafins by dracooties @ da | harris & hound for @strange-wobbly-inflatable-thing bc I straight up havent drawn him for 5 years.
I love this family too much heck
cascading.
nb person: uses they/them pronouns
people: but those are plural! because grammar!!! use singular pronouns.
nb person: uses nounself pronouns like fae/faer or kit/kits
people: what no you can’t just make up pronouns!! those are ridiculous use words that already exist
nb person: uses it/its pronouns
people: those are dehumanizing! those are pronouns for things, not people! don’t use those!!
nb person: uses she/her or he/him pronouns
people: but those are male and female pronouns not non-binary you can’t be a real nb if you use those pronouns. use something gender neutral!
nb person: uses common and decades-old invented pronouns like ze/hir or Spivak pronouns
people: no those are made up and silly!
nb person: uses no pronouns
people: you?? can’t just not use pronouns??? it’s impossible to talk about people without pronouns wtf
nb person: looks into camera like they’re on the office
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Nezabudka Cake on Instagram
Follow So Super Awesome on Instagram
can I please just like,,,
Marry this cake??? thanks
Pompomprin
tbh spirit animal
