this shit sucks. wish bulbasaur was real .
RMH
Not today Justin
🪼
Today's Document
tumblr dot com
art blog(derogatory)

blake kathryn
Keni

ellievsbear

bliss lane
macklin celebrini has autism
"I'm Dorothy Gale from Kansas"
official daine visual archive
The Stonewall Inn
Cookie Run:Kingdom Official!
𓃗

Andulka
$LAYYYTER

if i look back, i am lost

Product Placement

seen from Colombia
seen from Türkiye
seen from United States

seen from Argentina

seen from Türkiye

seen from Canada
seen from Germany
seen from Indonesia
seen from United States

seen from Germany

seen from France
seen from United States
seen from United States

seen from United Kingdom

seen from Costa Rica
seen from Bangladesh

seen from Malaysia
seen from Netherlands
seen from Portugal

seen from Türkiye
@nicdaclowny
this shit sucks. wish bulbasaur was real .

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
i love deleting things . its like. bye. lol
Resident Evil 4 » Leon Kennedy

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
the sexy girlbots are returning. nature is healing
It's like when they reintroduced wolves to yellowstone
YOU CALL THIS HEALING?!? I'M UNDER FUCKING SIEGE
- deer and other prey animals when they reintroduced wolves to Yellowstone
my blorbo appears on screen and I start making clicking-chattering noises like a cat when a bird flies past the window
guy that says grace before giving head
who wanna come over and clap when bad things happen in horror movies with me
oh you mean with hands
not ruling anything out
are you still okay with us calling you king, dude and other masc terms or should we just use neutral terms?
I really dont mind bein called anything lmao its all good
Okay boy repellent, love u 🫶🏻
not that.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Larval stage
I love showing people a picture of my cat for the first time and they go "aww" and then I say "her name is Pigeon" and they go "aww her name is PIGEON" bc this knowledge has made her cuter
this is Pigeon btw
pov: ur a mosquito or perhaps a spider
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Feeling Ethereal 👑
cant believe i’ve never shared arguably the funniest dms i’ve ever gotten in my life