god this feels like im being chased by a serial killer with a fucking boombox blaring this
this envokes primal fear in me
yeah this is actually really good
@nineofswords

tannertan36
noise dept.
d e v o n
đ©” avery cochrane đ©”
Lint Roller? I Barely Know Her

ellievsbear
RMH

Discoholic đȘ©

@theartofmadeline

⣠Chile in a Photography âŁ

Origami Around

#extradirty
art blog(derogatory)
â

pixel skylines
Show & Tell

Kiana Khansmith
Sweet Seals For You, Always

gracie abrams
macklin celebrini has autism
seen from United States
seen from Trinidad & Tobago

seen from Brazil
seen from United Kingdom
seen from Ukraine

seen from United Kingdom
seen from Algeria
seen from Vietnam

seen from Malaysia
seen from United States
seen from Brazil
seen from United States
seen from United Kingdom
seen from Japan
seen from United States
seen from Saudi Arabia

seen from Eswatini

seen from Indonesia

seen from United States

seen from United States
@femslashornothing
god this feels like im being chased by a serial killer with a fucking boombox blaring this
this envokes primal fear in me
yeah this is actually really good
@nineofswords

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
why are you, as a man, showing up early for work?
âRise and grind?â What are you grinding on? Cock?
early bird gets the "worm?"
Maybe a little too eager to please your manager⊠hoping for something more?
ohh... you're a hustler, eh?
what do you even need all that money for? to take men on dates?
little ceasers deep dick pizza
thatâs not what itâs called nor do i believe thatâs what you think itâs called. youâre simply being a wise cracker and itâs pathetic.
bringing back a classic

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
Favourite Designs: Chotronette âGalaxy Cakeâ Haute Couture Gown
âGrief turns out to be a place none of us know until we reach it.â
â
Joan Didion
(via
macrolit
)
PRIDE & PREJUDICE (2005)
dir. Joe Wright
rip to 5sos. they ainât dead, but theyâre killing their own career
wait did they actually have a career
whos 5sos
4. If the car pulls up to you run in the opposite direction.
5. Walk with your keys in your hands and keep a key between each finger
6. If they put you in the trunk kick out the headlights
7. If you get lost find a woman with a child. Never ask a man for help (this one was drilled)
That scream fire piece of advice is literally life saving
8. Watch your shadows and reflections, especially if someone is walking behind you. A split second notice is better than none and will help you.
Yes this last one really saves lives y'all I do it all the time
girls have to learn to view the world like international intelligence agents just to be safe walking down the street. smh.
guys pls pls pls reblog and girls pls pls pls be safe out there. terrifying and so sad that we have to worry about this on a daily basis
(Iâm an enby, but, frankly, this is helpful for anyone.)
- always tell someone where youre at and an approx time when youll be back
Add text replacement words in your phone if possible. Something short and memorable that you can send quickly to people in moments of emergencies.
E.g.
I f ing hate that we need to reblog this, people suck, but this will save lives.
DO NOT SCROLL PAST
Being female fucking sucks but yes this shit is important for everyone
Also, do not walk close to walls. It will be easier for someone so walk past you and push you against it or corner you.
If your gut is telling you to cross the street or change your path, do it. Donât risk it. Your body knows.
If you can, buy a large umbrella and walk holding it. Studies say that predators are less likely to attempt an attack on someone that could fight back. Keys around your knuckles is fine but youâll need to get very close to do damage. Umbrellas are more precise.
Avoid wearing headphones if you are alone on an empty street. Look aware.
Again: Stay. Away. From. Walls.
Entering an uber alone? Call your father (or anyone you trust) and say âhey dad! Yep, Iâm almost there, Iâm sending you the route.â outloud. Then proceed to send them the route so they can follow the uber drive. This will most likely intimidate the predator.
If you see someone in an uncomfortable or possibly dangerous situation, walk up to them and say âBetty, oh my god, I havenât seen you in so long!â. If she gets slightly confused, you can whisper and let her know youâre trying to help and that she should follow along. Walk together to another station or away from where you are. The man will most likely not follow. I have done this one 2 times and can be very helpful.
If you are unsure she needs help, you can pass her a note saying something like âhey, I noticed this man beside you is making you uncomfortable. If youâd like help, fake a sneeze right now and I will come up to you and pretend we are friends.â This is a long note, but its an example. Be discrete. If she follows along, proceed with the previous tip. This is helpful when youâre in a crowded train and you notice harassment.
Help your sisters. Trust them. Trust yourself. Be safe.
If you ever feel unsafe or need help, anyone is welcome to run upto me and ask me for help! Iâll go all mama bear and keep you safe!!!
https://docs.google.com/document/d/166g6Vo8Fb9H3FIZF2H6faEBHtFQSf7nVn_QxcJ9NMi0/edit?usp=sharing
I made this google doc covering 14 different self defense tips and tricks. it was made on January 15th, 2020 so it was before I decided Iâd come back to tumblr jhjshdbjfh.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
YA literature? You mean books about Super Special White Girl and Her Mysterious Brooding Boyfriend?
Hereâs a list of black YA leads! And ten Native American protagonists! And a list of ladies who love ladies in YA! And genderqueer / transgender YA leads! And more queer titles! And 2015 / 2016 YA books with Asian / East Asian leads! And bisexual YA leads! And Muslim YA leads! And asexual YA leads! And YA Interrobangâs entire section on diverse YA fiction! *confetti*
PLEASE REBLOG THIS
It just occurred to me that people do not know about what some people make chicken coops out of and itâs a Shame
Please, enlighten us
So the thing with chickens are, they are adaptable and frankly, do not care.
you
can
use
just
about
anything
Here are some more that I like:
Some fun facts about âvegan leather.â
Yes, it is plastic. Which means itâs breaking down and releasing micro-particles into the environment.
Thatâs bad.
Thereâs also the whole âplastic comes from oilâ issue and no, most vegan leather is not made from plant based plastic or recycled plastic.
Itâs also not recyclable itself.
It wears out faster, and is less repairable, so youâll have to buy new boots or whatever every couple of years instead of like. Once every decade and getting them occasionally fixed (for typically less than the cost of a new pair of vegan leather boots).
One of the attorneys I work with has a beat-up leather briefcase he was gifted when he passed the bar. In the 70s.
Another attorney bought a vegan leather one last year and he already has had to replace it.
It doesnât âbreath,â so your boots are more likely to smell than if they were made of leather.
It wonât form to your feet over time, so itâs less comfortable.
It also isnât anywhere near as warm in the winter.
It doesnât protect against various dangers and, in some cases, could make things much worse for the wearer. Ever had plastic melted to your skin? Itâs not fun.
I know someone that professionally butchers local livestock and game. A few years ago, she would sell hides to various manufacturers. Now, she canât even pay people to take hides. Her shop had to buy a bigger dumpster to hold the hides because they canât get rid of them.
Because no one wants leather anymore.
(I could go on and on about the ethics of the meat industry in america, but to stay on topic, I wonât. Send me an ask if you want to talk about it. Same goes for initial cost issues for low income people, because I know thatâs also a major thing)
Basically, as long as there is a market for beef in America, there will be hides that can be turned into leather. Yes, I know, there are a lot more complex issues in this, what with capitalism and all. See previous paragraph.
But the bottom line is that vegan leather SUCKS and people should avoid buying it whenever possible.
Vegan âwoolâ is also plastic, in case you were wondering, and it suffers from all of the same issues the above poster mentions.
HARRY POTTER AND THE CHAMBER OF SECRETS 2002 | dir. Chris Columbus
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming