The Pigeon on the Roof

To everyone near Arlington, Virginia: There's a special Tibetan festival coming to town in about 2 weeks time.

(Aaah, why does all the cool stuff always have to happen at the other side of the Atlantic?! :c )

I've been supporting International Campaign for Tibet for about 6 years now. Lately the support has become even more necessary since China has increased its grip on the area and the Tibetans are suffering from some very grim oppression.

Err, the Tibet Fest is a bit lighter in spirit though:

"Tibet Fest is a family-friendly event inspired by Tibetan Buddhist culture and the global concern for its survival inside Tibet. Attendees will have the opportunity to experience and explore the rich traditions of Tibet through an afternoon of activities for the whole family -- from making prayer flags, to sending His Holiness the Dalai Lama a birthday card. There will also be a Tibetan market providing the chance to take home a piece of Tibetan culture"

Read more here: http://action.savetibet.org/o/6063/t/0/blastContent.jsp?email_blast_KEY=146367

I don't blog much about these things, but I thought this would be a nice opportunity to learn a bit more about the culture and the country for everyone who's interested.

"Dinosaurs evolved feathers long before birds came on the scene, but why if they couldn't fly? Dr Dave Hone explains"

Very well written article about the plethora of other uses feathers could have had in early, non-avian, feather-bearing dinosaurs.

Read more here: http://www.guardian.co.uk/science/lost-worlds/2013/jun/05/dinosaurs-fossils

I curse him for the joke made at the start though:

"I for one would love to see a flying tyrannosaur"

Seven Science Books of Stuff You Wish You'd Never Heard Of

I found Sam Kean's "The violinist's thumb" during one of my many genetics-related internet searches. The book sounded like a very nice read and so I started looking for more. However the search quickly went from "that's nice to know"-books to "dear god why"-like stories.

So for your pleasure, a compilation of 7 books that start out innocent enough, but quickly digress into horrible diseases, deadly (and exploding) shrubs and the worst bugs you'll ever find walking the face of the Earth.

More info on the reads:

http://www.goodreads.com/book/show/7247854-the-disappearing-spoon

http://www.goodreads.com/book/show/13521382-the-violinist-s-thumb

http://www.goodreads.com/book/show/299960.The_Earth_Moved

http://www.goodreads.com/book/show/6106482-wicked-plants

http://www.goodreads.com/book/show/9845802-wicked-bugs

http://www.goodreads.com/book/show/16213.The_Hot_Zone

http://www.goodreads.com/book/show/457932.Killer_Germs

The people at the UC Davis Bioinformatics Core are gigantic nerds.

Precious.gigantic.nerds.

(I kind of want that shirt.)

Where did that pigeon go?

Hi guys, I'm not dead yet!

In these past few weeks, I've been working hard on my internship. The downside: it's 1.5 hours travelling by public transport between Utrecht and Harderwijk. By the time I'm home, I'm hungry, tired and then I still need to cook, clean and take care of my own administration. The laptop usually stays switched off. I already spend 8 hours behind that thing at my internship, so I usually don't feel like doing so again by the time I'm home.

As a consequence, Tumblr-time has been suffering. (and IchiKai-time, Facebook-time, manga-reading-time, etc.)

And I don't think it'll become better in the near future. Because last weekend I moved house! I now temporarily live in Ermelo, which is only a 20 minute bike ride away from work. The little house I live in is beautiful and in the middle of the forest.

But.

It's a vacation home. Aka: NO.INTERNET.

I bought prepaid internet, but the USB adapter cannot pick up a stable 3G connection there. And 2G is kind of like having no internet. It feels nostalgic. Very 90-ies.

Luckily there is a fast wifi connection at work so I try to do everything there, but I don't have a lot of privacy and my Tumblr dash is not exactly SFW. 8D

Alone-time at home is now spent reading Sherlock Holmes on the small terrace at the south side of the house. Or trying to determine that one funky species of grass that is growing in the lawn (botanist nerd-level reaching max. capacity). Or destroying the dandelions that are sprouting up everywhere. And most of all: listening to the birds. There are so many birds there, my god. At 5:10 AM, when the sun rises, the forest EXPLODES into mass bird-song. Kind of impossible to sleep through it, but beautiful nonetheless. (I bought ear-plugs anyway).

Oh, and there is an amazingly large television there with HDMI access, so I can hook-up my laptop and blast Nine Inch Nails for a... change of pace. (No neighbours! Wooh!)

I'll see if I can upload some pictures sometime. The Veluwe is an amazing nature reserve in the middle of the Netherlands. It's one of the largest stretches of woodland in Europe and now I'm using it as a short-cut to get to the supermarket! Quite a difference from the industry terrain I normally live on in Utrecht..

My internship lasts until about the end of July. Maybe I'll get some posts in when I run into something interesting on the web while I'm at work, but I don't think I'll be able to get back to a lot of comments, let alone stay up to date on what you guys are up to. :(

So.. I miss you guys. You haven't been forgotten. Once this internship is done and I've finished my Master's, things'll get back to normal (I hope).

And now I have to get ready to get to seenisambol's b-day party. :D

Have a good weekend everyone (and happy Liberation day tomorrow for all you Dutchies out there!) and see you soon!

mangy-mongrel replied to your link: TCATAGTTGTAAATATAGATAAACCGTTTGTAAAACCATATAATTTAGCATGAG

OMG I wanna work at your place HOWW

Haha! I know right? :P

Though slight context: it's a small company with currently only 8 people working here (including myself), allowing for a lot of informal contact between employees.

Wait, what was that?

Just go to the above link, jot the DNA sequence into the top box, check the 'DNA to text' box and watch the message appear. :)

This is a translator tool that was sent around the company by the top management.

My internship place is being run by absolute nerds.

Taking one gene as the 'starting point', the gene connectome then maps all other known human genes around it. The distance towards the center denotes how closely related each gene is to the reference in terms of functionality. Meaning: several genes that take part in the same pathway will show up closely together on the map.

The image takes gene TLR3 as an example.

Below the image is a quote from the article with an example on how they used it for research.

"The researchers also used the TLR3 connectome -- the set of all human genes sorted by their predicted distance from TLR3 -- to successfully predict two other genes, EFGR and SRC, as part of the TLR3 pathway before they were experimentally validated, and applied other gene connectomes to detect Ehlers-Danlos syndrome and sensorineural hearing loss disease causing genes."