MASTERLIST | 🇧🇷 | Gamer, writer, artist | Let's talk about Dragon Age, Mass Effect, Enderal, Fallout, Interactive Fiction and anything else on the mind | +30 years
(Previously gabrielerudessa; also just changed pfp from my Norm Maclean x OC to Simon Iron Lung with a crown of flowers because I really liked this art. Probably pfp will remain for a long time or until I make some new art that makes me go YOU lmao)
Fanfics, Fanarts, and Meta analysis
Alien Franchise Masterlist
Fallout Masterlist
Iron Lung Masterlist
Pillars Of Eternity
Not Strong Enough (Hiravias x F!Watcher, NSFW) AO3 | Song
Arts in General
Multiple Fandoms (Enderal, The Evil Within, The Wayhaven Chronicles, Dragon Age)
Original Works
Video Edits
Iron Lung (Rimani - Gabriele D'Annunzio, proclaimed by Paul Damian)
Iron Lung (Realization - Weird Wolves)
Project Hail Mary (Children of the Sky - Imagine Dragons)
Lucy Maclean (Devil Devil - Milck)
PSA:
The few x reader pieces I have atm, in general, I aimed to write with no physical characteristics like body type, skin color or hair texture mentioned, but maybe something slipped. Please fell free to reach out and warn me, I'll be glad to fix it. This extends to gender neutral: if it says it's GN and something breaks this, let me know and I'll fix it.
Some of these, reader has a few specific characteristics mentioned. These are clearly warned in the post itself, and anything beyond was an accident. Again, feel free to reach out.
Planned Fics/WIPS (The border between both is very Thin) (not fully exausted list, there's a bunch i left out because it's mostly Vibes and no Title yet LOL)
Fallout:
We Love Like Ghosts (Request, Maximus x Fem!Reader => Planned, half written, need to finish it)
Hourglass (Thaddeus x OC Goose Bear => Finish writing it, next chapters Fully planned, need to lock in and write)
Timezone Part II (Norm Maclean x OC Marigold Bear, soulmate AU => Planned)
Appetite (The Ghoul x OC Fátima "Bear" => Planned)
Hysteria (Mr House x OC Rosemary Lecter x House Double => Sequel to Curiosity Killed the Moth, started writing, need to finish)
Flesh (Mr. House x OC Rosemary Lecter x House Double => planned, conclusion to Curiosity Killed the Moth)
Dark Things (Norm Maclean x OC Rosemary Lecter and eventually x Claudia => general plans only)
Short Change Hero (Maximus x Lucy Maclean, Maximus Week => started, next chapters planned, need to finish writing)
Fight (Maximus x Lucy Maclean => Vaultknight Week prompt 7, planned, conclusion to Evergreen)
The Glory and The Scum (Mason x Sole Survivor May => started, need to finish)
Gravity of You (Norm Maclean x OC Ace => Fully planned, need to write)
Love You to Death (Norm Maclean x OC Marigold Bear => one shot, planned)
Alien
Out of Sight Out of Mind (Walter One x GN!Reader => Synthmas, started writing, need to finish)
Invincible (Title may Change) (Andy x GN!Reader => Synthmas, planned)
Terminal (Bishop x GN!Reader => Synthmas, planned)
Unnamed Kirsh x Elevator Reader (Crackfick idea that MUST BE on this list LOL)
Lunarblood (Kirsh x OC Yautja Zi'idre => overall planned)
Overboard (Kirsh x Alien Mermaid Reader => overall planned, thinking of turning reader into a full OC, somethings written)
Dystopia (Kirsh x GN! Reader => Overall Planned... Same Reader from We Almost Had It)
Iron Lung
Bluebeard's Chambers (Alpha! Simon x Fem! Beta! Reader => Planned, started writing, planned to be 3 4 chapters only, Simon survives AU. Yes, Simon is in a Rut and Reader helps)
Dead Man's Arms (Simon x OC Cássia dos Santos García => Planned, started on, Iron Lung x The Evil Within smashed together)
Moonlight Rendezvous (Simon x OC Loreley x Ava => Planned, Iron Lung but let's make things similar to The Passenger IF by throwing an Eldritch Being stuck in a human body escaping another)
Clair de Lune (Simon x OC Tiffany => planned, Simon survives AU)
Other Fandoms in General
Sanctuary (Bioshock. Jack Wynand x OC Monica O'Neill => Planned)
Not Strong Enough (Pillars of Eternity. Hiravias x Fem! Watcher => Planned. Future chapters need writing)
Unnamed Miraak x F!Dragonborn (Skyrim. Started)
Unnamed Gaichu x OC Matriarch (Shadowrun. Started)
Unnamed Ondolemar x F!Dragonborn (Skyrim. Started)
Unnamed Tharael Narys x Prophetess (Enderal. Started)
(sighs and adds) Stars (Jedi Fallen Order. Cal Kestis x OC Adhara Norte => Plans so many plans. Def Multi chapter)
Dopamine Kisses (Jedi Fallen Order. Cal Kestis x GN! Reader => Very planned in details. HOPEFULLY one shot)
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions
Free to watch • No registration required • HD streaming
Tumblr email about the post analysis on the Seedling that has a bunch of screenshots OF A SEEDLING PENDANT:
"We’ve reviewed the classification appeal on your post and have determined that it does not contain sexually explicit content per our Community Guidelines.
As a result, your post has now been restored!"
Me looking at the Post still in the flagged posts and unable to be acessed by anyone but me:
(i tried to research another crying gif by typing "crying" and tumblr showed in the gif search a "are you okay to you need to speak, numbers for suicide hotlines" NO TUMBLR I AM NOT OKAY AND YOU ARE THE ONE TO BLAME)
I wanted to bring this up in my outfit retrogressive art, but I've been thinking about Simon's outfit in the movie cus I'm pretty sure most of his fit was given to him by the COI.
We see Eden does have white/pale colors in their fits, but only as accents to the muted browns, greys and blacks. Behold a BTS shot that is super cute:
Note the bright turquoise sash and the baggy shorts, and how it compares to a brightened screenshot of the movie. The sash and the white shirt on that one kid seems the brightest things in the group, and even the white shirt is under a black vest.
Then look at the COI.
They all seem to have, if not (dirty) white coveralls like Ava, then (also dirty) white pants like Jack and David. not, David the character by Troy Baker, David Syzmanski David. Speaking of, where are his BTS shots? I need to know what his fit looks likeeeee!
The pants while not being literally the same that Simon wears, are pretty similar in materials, pocket situation and having dark/black additions for reinforcement. Note how Simon's pants sort of match color-wise in this BTS picture too, and the black inseam:
Of course it won't be a perfect match because at the end of the day, these are fits acquired ready-made by the costuming department, so there won't be exact matches in textiles. But let's just think in-universe. It better fits the COI standard pants rather than what Eden has going on.
I also can't see the front of Jack's belt on the photo above, but it looks quite similar to the one Simon wears in width and color. And is that a purple knit sleeve i see??
Perfect segway for Simon's shirt. It's a closer match to Eden's outfits but I doubt it lasted however long he was in prison for. It doesn't take to damage well, given how easily it gets torn throughout the movie.
I wonder if it was made by frogging previous outfits and then reknitting it, thus wearing down the fiber. Maybe the thread itself was woven of lesser quality fiber, too. Honestly if you can repurpose weave fabric into knit, then I think you can be quite set in regards to outfits. Not the most resilient fabric type, but in a post-apocalyptic pinch? Might as well. Eden itself has mostly knit fabric fits as well, even more than the COI!
I genuinely can't explain the sew lines beyond aesthetic preferences ngl, cutting up knit fabric to patch it up is an exercise in waste.
His shoes are a conundrum. If you notice the earlier Eden child outfit, the boots are leather. Simon has sturdier but still decidedly leather boots. Whether it might be real or plastic leather, it's anyone's guess tbh. He also has the snake gaiter protection that Not-Troy-David has, though different color. I'm assuming to protect them from any splashes from the blood while in the hanger/sub?
Anyway, the soles are the biggest difference. Eden kid has low soles, while the COI and Simon have some sturdy plastic soles. Now this could be because Eden didn't have enough kid-sized shoes, and they made one in a pinch until the kid grew into more available adult sizes. It also matches with Eden, having a larger population, also had to repurpose outfit materials into more clothes than the COI, which the larger amount of knit fabric can also imply.
Hard to say if those are COI-issued or Eden-issued boots overall, it could easily be either of them.
At the most conservative interpretation of all of the above, his pants were a replacement pair from the COI. At the most radical interpretation? Simon might only have the cowl (and attatched knife holster) and the pendant bracelet left from Eden.
Track of the day is 20th Century Blues by my all-time favourite singer and playwright, Noel Coward! If you're not familiar with his ouevre, I *highly* recommend deep diving on him. He''s a fascinating and complicated figure. He died only a week after his favourite cat passed away. An all time real one.
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions
Free to watch • No registration required • HD streaming
Back in the day I worked at a certain very famous and very high caste art museum in the US as a junior curator. Part of my job was to catalog the objects in the museum database. This includes details like provenance, measurements, and a visual description of what the object looked like.
Like I said, the museum was a pretty snotty institution. It’s got a LOT of objects it’s way famous for possessing, but nobody knew about the absolutely massive collection of Moche erotic pottery it had because the curators were totally embarrassed by this stuff.
Some examples:
Pretty hot shit, right? They never, ever put any of this stuff on public view or published it in any catalogues but - we legit had like several hundred pieces of Moche ceramics in the “dirty pots” category. Anyway, I was left alone to just do my job with regard to the database for several years, ok? And I figured, well, these’re accessioned objects in the museum’s collection - better get down to bidness.
I catalogued every goddamn bestiality, necrophiliac, cocksucking, buttfucking, detached penis, and giant vulva drinking cup in that collection. I’d be like,
A drinking vessel in form of a standing man wearing a tunic and cap. He holds an oversized erection in his hands and stares into the distance (note I did not say “like he’s hella-constipated”). The vessel has a hole at both the tip of the penis as well as around the rim of the figure’s head, thus forcing the drinker to drink only from the penis or risk spilling wine all over themselves from the top of the vessel. Red and orange slip covers the surface of the piece.
Pretty straightforward, right? Apparently the deep seated fear of these objects that the curators exhibited was meant to spread to me as well, but - no one ever gave me that memo, because I guess Midwesterners reproduce asexually. When the curators understood that I had catalogued all of these objects in addition to the other, non-sexy pieces in the collection, they were apparently livid, but knew they had no legs to stand on in terms of getting pissed at me for it.
I visited the museum’s online public access database a few years back and - every single description I wrote of these pieces has been totally neutered to say something like Male figural vase.
Long story short? Just call a dildo a fucking dildo. It’s all gonna be ok, I swear.
Museums should have sections dedicated to artifacts like these with a warning that says “There’s a lot of private parts in here but we’re dedicated to displaying history so we won’t censor these. Enter at your own risk” or something. It’s prudish to deliberately hide history because of some ding dongs.
Always funny to me when indie devs who already sell games for dirt cheap participate in steam sales with like 90 percent off. Like. "Yeah this game is three dollars but you can have it for one right now." Like your game costs as much as a pack of m&ms and youre selling it for the cost of a pack of m&ms in the 1950s now? Okay
💔 I am a father of five, and I live with my wife and children in extremely harsh conditions. We are seven people trying to survive day after day amidst the ongoing war in Gaza.
Hello, I'm Shadow and I'm raising money for my friend Hussam and his family who are facing war and hardship in Gaza:
🏕️ Many people think the war is over, but for us, it hasn't. It may have disappeared from the news screens, but the truth is that the danger persists, displacement and forced migration are still a part of our lives, and fear is our constant companion.
👨👩👧👦 I cannot go to work or provide for my family's needs because I stay in the tent to protect and care for my children in these difficult circumstances.
🍼 My youngest daughter desperately needs milk. 👶 She also needs diapers and clothes. 💔 I am unable to provide these basic necessities for her.
🙏 I am writing these words and appealing to anyone who can help. Any support, no matter how small, can make a huge difference in my children's lives and give us hope during these difficult times.
🌍 If you are unable to donate, sharing this post may help our story reach people who can help
🤲 We ask for nothing more than the opportunity to live with dignity and provide for our children's basic needs.
❤️ A heartfelt thank you to everyone who reads, shares, or offers any kind of support. Every little bit of help means the world to us..
This is our tattered tent.
Hello, I'm Shadow and I'm raising money for my friend Hussam and his family who are facing war and hardship in Gaza:
friendly reminder that Simon knows what it is to run under an open sky, and to breath unrecycled air, and watch a sunset. Friendly reminder that he refused to believe that Mars, his first and true home, was gone, choosing to believe that it was still there to miss them. Reminder that while most people in Eden and the COI had grown up on space stations, and the concept of planets and a different life is a nebulous desire, Simon's dreams were just of home
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions
Free to watch • No registration required • HD streaming
sometimes i feel bad for having mostly female ocs and then i remember the large amount of people who are so obsessed with men and mlm ships exclusively to the effect of rampant violent misogyny so i think im ok
ill get too into my own little bubble like "oh no i must be overdoing it having so many women.... i really should diversify" but then stepping out and realizing that no it seems im far more in the minority than i thought and theres a scarily disproportionate amount out there who wouldnt even consider adding One
Hey guys!!! So i’m in the middle of protein synthesis cause i can do whatever tf i want, and i’m wondering if ANY of yiu can read the letters below the first strand
all those yellow lines have letters underneath (each is a strand of dna) so if you could type out the strand letters to me i would love that so much omg👀
i’m trying to put it into a google slide dec of the decoding for this photo, but my vision is cheeks so i’m gonna throw this out into the world and hope one of you catch it mid air😭
I wanted to recheck, so I "beautified" it at the same time 'cause I didn't trust my pen and paper previous transcription
AGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATT
GGTACTGGATGAACTGTTTATCCCCCTCTGGCTGCAGCCATTGCCCACGCAGGGGCCTCGGTGGACCTTGGGATTTTTTCTGA?
Now I'm pretty sure this is it... Only letter I couldn't be too sure was the very last one (marked it ?)
Have fun now! :)
Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions
Free to watch • No registration required • HD streaming
