ok universe, i’m ready to feel good things. make me feel good things.
whenever i post this it works reblog if u want to feel good things & the universe will bring u something sweet
One Nice Bug Per Day
Not today Justin
noise dept.
YOU ARE THE REASON
NASA
art blog(derogatory)
Interview Vampire Daily
Doug Jones

gracie abrams
The Stonewall Inn
The Bowery Presents

blake kathryn
Cosmic Funnies
tumblr dot com
$LAYYYTER
RMH
KIROKAZE
seen from Finland

seen from United Kingdom
seen from Malaysia

seen from Malaysia

seen from Germany
seen from United States

seen from Spain

seen from Malaysia
seen from United States
seen from United States
seen from United States
seen from United States

seen from Malaysia
seen from United States
seen from United States

seen from United States

seen from Vietnam
seen from United States
seen from United States
seen from United States
@astrastasis
ok universe, i’m ready to feel good things. make me feel good things.
whenever i post this it works reblog if u want to feel good things & the universe will bring u something sweet

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
My friend claimed he could play Flight of the Bumblebee and accompany himself. Then he did this.
ITS BACK
im crying
THIS IS THE BEST THING IVE EVER SEEN
screenshots dont do this justice
*inhuman clicking*
the millennial steve irwin
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
stop the "hewwo" meme
its appropriating DD/LG culture and making fun of it, which invalidates our experiences! we didnt choose to have this kink and haha just kidding but could you fucking imagine.
god every time this meme comes up it gives me so much fucking whiplash

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
proof that tik tok is dark vine
The dead sea is less salty 😂😂
“He’s just a kid, he can fall over”
iM WHEEZING
Lmao
Idek why this was so funny.
All bc there’s no Thor 😂
ok universe, i’m ready to feel good things. make me feel good things.
whenever i post this it works reblog if u want to feel good things & the universe will bring u something sweet

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
A better, more positive Tumblr
Since its founding in 2007, Tumblr has always been a place for wide open, creative self-expression at the heart of community and culture. To borrow from our founder David Karp, we’re proud to have inspired a generation of artists, writers, creators, curators, and crusaders to redefine our culture and to help empower individuality.
Over the past several months, and inspired by our storied past, we’ve given serious thought to who we want to be to our community moving forward and have been hard at work laying the foundation for a better Tumblr. We’ve realized that in order to continue to fulfill our promise and place in culture, especially as it evolves, we must change. Some of that change began with fostering more constructive dialogue among our community members. Today, we’re taking another step by no longer allowing adult content, including explicit sexual content and nudity (with some exceptions).
Let’s first be unequivocal about something that should not be confused with today’s policy change: posting anything that is harmful to minors, including child pornography, is abhorrent and has no place in our community. We’ve always had and always will have a zero tolerance policy for this type of content. To this end, we continuously invest in the enforcement of this policy, including industry-standard machine monitoring, a growing team of human moderators, and user tools that make it easy to report abuse. We also closely partner with the National Center for Missing and Exploited Children and the Internet Watch Foundation, two invaluable organizations at the forefront of protecting our children from abuse, and through these partnerships we report violations of this policy to law enforcement authorities. We can never prevent all bad actors from attempting to abuse our platform, but we make it our highest priority to keep the community as safe as possible.
So what is changing?
Posts that contain adult content will no longer be allowed on Tumblr, and we’ve updated our Community Guidelines to reflect this policy change. We recognize Tumblr is also a place to speak freely about topics like art, sex positivity, your relationships, your sexuality, and your personal journey. We want to make sure that we continue to foster this type of diversity of expression in the community, so our new policy strives to strike a balance.
Why are we doing this?
It is our continued, humble aspiration that Tumblr be a safe place for creative expression, self-discovery, and a deep sense of community. As Tumblr continues to grow and evolve, and our understanding of our impact on our world becomes clearer, we have a responsibility to consider that impact across different age groups, demographics, cultures, and mindsets. We spent considerable time weighing the pros and cons of expression in the community that includes adult content. In doing so, it became clear that without this content we have the opportunity to create a place where more people feel comfortable expressing themselves.
Bottom line: There are no shortage of sites on the internet that feature adult content. We will leave it to them and focus our efforts on creating the most welcoming environment possible for our community.
So what’s next?
Starting December 17, 2018, we will begin enforcing this new policy. Community members with content that is no longer permitted on Tumblr will get a heads up from us in advance and steps they can take to appeal or preserve their content outside the community if they so choose. All changes won’t happen overnight as something of this complexity takes time.
Another thing, filtering this type of content versus say, a political protest with nudity or the statue of David, is not simple at scale. We’re relying on automated tools to identify adult content and humans to help train and keep our systems in check. We know there will be mistakes, but we’ve done our best to create and enforce a policy that acknowledges the breadth of expression we see in the community.
Most importantly, we’re going to be as transparent as possible with you about the decisions we’re making and resources available to you, including more detailed information, product enhancements, and more content moderators to interface directly with the community and content.
Like you, we love Tumblr and what it’s come to mean for millions of people around the world. Our actions are out of love and hope for our community. We won’t always get this right, especially in the beginning, but we are determined to make your experience a positive one.
Jeff D’Onofrio CEO
Tumblr commits toaster bath, more at 7
i wish somebody looked at me like the way he looked at that onion
That final scream
@colacharm
Sunday night comic
im dead about to combust over this fucking tag i cant do this
i cant believe the empire stole all the damn glass from morrowind just to create these abominations
@divaythfyr HURFXDGVUJNKJHFSSK
this is the gamergate army uniform

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Numb // Linkin Park 80s Remix
this remix is basically this image:
@curiouslich @brothersemberfell
@ladyvanguard