Tumblr Sexyman Contest 2026 Final Round
Senshi (Dungeon Meshi)
Ryland Grace (Project Hail Mary)
Mr. Ant Tenna (Deltarune)
Tenna art by @9Aaaalt29 on twt
KIROKAZE

One Nice Bug Per Day
Show & Tell
Fai_Ryy

roma★
Noah Kahan
YOU ARE THE REASON
cherry valley forever
Lint Roller? I Barely Know Her
🪼

titsay
Aqua Utopia|海の底で記憶を紡ぐ
EXPECTATIONS
official daine visual archive
Cosmic Funnies
noise dept.

PR's Tumblrdome

seen from United States

seen from United States

seen from United States
seen from Switzerland

seen from United Kingdom
seen from United States
seen from Germany

seen from United States
seen from United States
seen from United States
seen from United States

seen from Mexico
seen from Hungary
seen from China
seen from United States
seen from United States
seen from United States

seen from United States
seen from Bangladesh

seen from United States
@sehoratyehet
Tumblr Sexyman Contest 2026 Final Round
Senshi (Dungeon Meshi)
Ryland Grace (Project Hail Mary)
Mr. Ant Tenna (Deltarune)
Tenna art by @9Aaaalt29 on twt

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
“Any cemetery is already a ghost village, but this one is a ghost village planted within a ghost village. Outside the graveyard gates, there’s too little sound of human bustle.”
Gregory Maguire Egg and Spoon
-
Recently I started reading Egg and Spoon and the second chapter was so melancholic and it gave me an idea for a short comic.
This is just title page I made for it and hopefully I’ll have the full thing done in the near future!
Go! Rocky, Go!
Sorry but it's not complete without...
coming back to tumblr after being away for so long feels like greeting an old friend haha it still maintains bits of the early 2010s internet i remember from middle school

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Collection of Free Art Tutorials
I don't usually make text post on this blog, but a nice artist I know was asking for tutorials a while back and I forgot to send some to them while in school. So here's a post on it since it's easiest to grab and go this way. :)
This list focuses on the basics. I'm focusing on the foundations of art, so medium is generally irrelevant and you can use physical or digital with these. You'll have to google more specific tutorials on things like character design and such.
One of the biggest pieces of advice I can give to you is strangely, introduce things to yourself one at a time. In art class, we took whole topics week by week. For high school, we did a few exercises then spent a week drawing/painting and doing your piece(s). For basic art 1 & 2 in college, we did 1-2 exercises and then did 1-2 drawings, followed by HW (which we turned in next week) and sketchbook practice (which she'd check at midpoints). For basic art lessons with a tutor, we did practice then our own art. You can see the pattern here - the point is don't be distressed if you don't get everything at once, or the lesson in 2 weeks, or the lesson in 3 years - we practice and do a lot over time, and you'll pick up on things you need to improve naturally and through help with others. Take time to be proud of your art in mini steps too, even if it's not the best! You tried and attempting to climb an obstacle over and over again before finally leapfrogging it is still progress to it.
Overall tutorials:
DrawABox.com is a site that's dedicated to art exercises and practicing when you can. They talk about the basics of art as well as how practice is important. It can get tough at times and it's ok to stop and do a balance of say those practices and doodles if you choose to try and do all of it's stuff - but you don't have to either. It's just a nice basic education done by some art nerds who like going hard.
Ethering Brothers - these guys are famous for their 40billion tutorials. If you need help on a specific idea, search their gallery and you'll likely find something.
Thundercluck's Art Fundamentals - She did a good huge ass tutorials on how things work, and it's the least overwhelming of the 3 I got in this section, so I suggest it as one of the first to look at for digital stuff.
Thanks for the mention and putting this together! @artfromsaturn
bat wings 🍂🦇
>First, we’ve discovered that about a quarter of all the internet connection in or out of the house were ad related. In a few hours, that’s about 10,000 out of 40,000 processed.
>We also discovered that every link on Twitter was blocked. This was solved by whitelisting the https://t.co domain.
>Once out browsing the Web, everything is loading pretty much instantly. It turns out most of that Page Loading malarkey we’ve been accustomed to is related to sites running auctions to sell Ad space to show you before the page loads. All gone now.
>We then found that the Samsung TV (which I really like) is very fond of yapping all about itself to Samsung HQ. All stopped now. No sign of any breakages in its function, so I’m happy enough with that.
>The primary source of distress came from the habitual Lemmings player in the house, who found they could no longer watch ads to build up their in-app gold. A workaround is being considered for this.
>The next ambition is to advance the Ad blocking so that it seamlessly removed YouTube Ads. This is the subject of ongoing research, and tinkering continues. All in all, a very successful experiment.
>Certainly this exceeds my equivalent childhood project of disassembling and assembling our rotary dial telephone. A project whose only utility was finding out how to make the phone ring when nobody was calling.
>Update: All4 on the telly appears not to have any ads any more. Goodbye Arnold Clarke!
>Lemmings problem now solved.
>Can confirm, after small tests, that RTÉ Player ads are now gone and the player on the phone is now just delivering swift, ad free streams at first click.
>Some queries along the lines of “Are you not stealing the internet?” Firstly, this is my network, so I may set it up as I please (or, you know, my son can do it and I can give him a stupid thumbs up in response). But there is a wider question, based on the ads=internet model.
>I’m afraid I passed the You Wouldn’t Download A Car point back when I first installed ad-blocking plug-ins on a browser. But consider my chatty TV. Individual consumer choice is not the method of addressing pervasive commercial surveillance.
>Should I feel morally obliged not to mute the TV when the ads come on? No, this is a standing tension- a clash of interests. But I think my interest in my family not being under intrusive or covert surveillance at home is superior to the ad company’s wish to profile them.
>Aside: 24 hours of Pi Hole stats suggests that Samsung TVs are very chatty. 14,170 chats a day.
>YouTube blocking seems difficult, as the ads usually come from the same domain as the videos. Haven’t tried it, but all of the content can also be delivered from a no-cookies version of the YouTube domain, which doesn’t have the ads. I have asked my son to poke at that idea.
fastest reblog in the west
Yeppers. :)
reblogging for study later AND to spread the info.
Seriously, get and run PiHole if you can. It changes your internet experience so much for the better. I get shocked when I visit a website when I'm someone else's network, by just how many ads the internet is flooded with now. Take back control.
STEVE STOP
Mulan (1998) // Hercules (1997)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
BEST. VIDEO. EVER.
Oh God!! 😂😂😂
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
reblog before dec. 17th guys
I almost failed my fucking physics test because I had this stuck in my head
OOF! OOF! how does FIFTEEN POINTS of DAMAGE TASTE?!
I’ve been searching for this for 20 minutes.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Anime Girl: *breathes* Her Tiddies:
my cat does this before he pukes