㠤㠤㠤㠤㠤㠤㠤㠤Ėāā§ź°į š ą»ź± ā§āĖ
Click the green text ā directly sent to my strawpage.
Aqua Utopiaļ½ęµ·ć®åŗć§čØę¶ćē“”ć
Doug Jones
Claire Keane

tannertan36
Cosmic Funnies

oozey mess
Xuebing Du
Fai_Ryy
Cosimo Galluzzi
Monterey Bay Aquarium

Andulka
𩵠avery cochrane š©µ

romaā
PUT YOUR BEARD IN MY MOUTH

Origami Around

Jar Jar Binks Fan Club
The Bowery Presents

seen from France
seen from Brazil
seen from Canada

seen from Mexico

seen from United States
seen from France
seen from Brazil
seen from Argentina
seen from Vietnam
seen from United States
seen from Argentina
seen from United States
seen from Iraq

seen from United States
seen from Austria

seen from United States

seen from Germany

seen from United States

seen from Romania

seen from United States
@reecesplotdevice
㠤㠤㠤㠤㠤㠤㠤㠤Ėāā§ź°į š ą»ź± ā§āĖ
Click the green text ā directly sent to my strawpage.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
It's my 3 year anniversary on Tumblr š„³
I'm such a haaaaaaag
I didn't interact with you because of your boundaries, it's not because of "I find what do is bad". I thought it was interesting what you do, it's just that with what was said I couldn't bring myself to fully interact with you. I blocked you because I didn't want you to see what I do with the thing you were protective of, it's so we didn't have to cross paths if you blew up at me or something like that. I'm sorry I never said anything after finding that out, I thought your art was cool and I wish you the best on what you're going to do next. It's up to you if you accept this or not and that's okay if you don't. We never really interacted so I doubt that my words are worth anything anyway...
I just log in to this account to clear notifications and change my layout. Who are you and what are you exactly referring to? If it's my strawpage that's been outdated for a long time
Rating some Whippa ships i found in the fandom:-
(Note: self and oc ships not included)
1- Qhippa (Quinn x Whippa)
Art by @watercat72 on tumblr
6-7/10
I kinda see it but not my cup of tea. I think police and law people would dislike the duo because of how they got away from what they did.
2- Whiplee (Whippa x Koilee)
Art by @koriloveswhippa on tumblr
11/10
MY FAVORITE ONE. I think their chemistry is cute and I wanna get rid of my writersā block to do something for them.
3- Whipjoy (Whippa x Joy) (both alter egos included)
Both Arts by @muddaisy on tumblr
7.5/10
The ship kinda ate ngl. But I prefer the canon joymoe (sorry).
4- Whippa x Janana (not sure if itās a ship but Iāll include it anyways)
Art by @cluelessthecoolest on tumblr
5.5/10
I donāt see it.
5- Whippa x (Mitch, Hacky Zak, and Gremmie)
Post by @alaskacoolkid1 on tumblr
3.5/10 with Zak and Gremmie
4/10 with Mitch
I donāt believe in straight Whippa. But some bonus point for Mitch because I think the ship dynamic would be funny.
6- (Whippa x Prudence)
Edit by @reecesplotdevice on tumblr
6.5/10
The ship might be cute opposite attracts but I like cooper x prudence more.
7- Doan x Whippa
Photo by @chloe_butterberrys on instagram
2/10
No
Doan is a real person and again I donāt see Whippa with a man.
8- Whippa x Gabitha
8.5/10
Interesting a bit too much.
Itās just my opinion.
If there are any more Whippa ships, tell me about it/them.
And Mousse x Whippa sibcest shippers, GET THE FUCK OFF.
I just saw this now hello?? Uhmm thanks for the credit because there are people in this community who wouldn't be decent enough to do so.
but I immediately saw the mention of coopdence and I would like to mention that I have that ship on my dni and I'm more of a mousse x cooper, so if you're gonna interact with my work, sorry. Atleast your honest with the rating I guess. No offense given or taken.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
For my Sonadow loversšš
Stop liking the fucking original now. Fucking bitch.
May I ask why you have GCTAGCTAGCTAGCTAGCTACTGA in your banner? Who's DNA is that.
It's a filter under the object category in Glitch Lab, which I used for my layout :)
Note: Mode was where I got the specific one for my banner

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
Remember that chart I made last year? Here's the uploaded version lol
Lemme know when we get the 3d renders of the cowboys
#sonadow
It's my 2 year anniversary on Tumblr š„³
2 YEAR ANNIV 6 DAYS AGO I JEEP FORVETTING MY TUMBLR HI
Silent Hill 2, 2001
Freakazoid2000
I accidentally drew 6 fingers on his left hand and I didn't notice after I literally posted it to two of my sps focused socials. This one is edited to remove the accidental extra finger so do NOT CANCEL ME FOR AI!!!!!!!!!!!!! 1!!!!!! 1! 11! 1! /JOKE

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
me when im the fast and furious swan boat (flamingo)
art trade with @reecesplotdevice
Dude...... Hell yeah.............
What do you mean I forgot to post this before posting the cookie kitsunes.
Anyways, old wip from March I decided to finish