ㅤㅤㅤㅤㅤㅤㅤㅤ˚₊‧꒰ა 𓂋 ໒꒱ ‧₊˚
Click the green text → directly sent to my strawpage.
almost home
YOU ARE THE REASON
todays bird

pixel skylines
i don't do bad sauce passes
Monterey Bay Aquarium
noise dept.

if i look back, i am lost

@theartofmadeline
Sweet Seals For You, Always
2025 on Tumblr: Trends That Defined the Year
let's talk about Bridgerton tea, my ask is open
Jules of Nature
Acquired Stardust

Product Placement


blake kathryn
Aqua Utopia|海の底で記憶を紡ぐ
I'd rather be in outer space 🛸
PUT YOUR BEARD IN MY MOUTH

seen from Türkiye

seen from United States

seen from Sweden

seen from Germany
seen from United States

seen from United States

seen from Hungary

seen from United Kingdom

seen from United States
seen from Germany
seen from South Africa

seen from United States

seen from United States

seen from Germany

seen from Germany
seen from United Kingdom
seen from United States

seen from United States

seen from Taiwan
seen from United States
@reecesplotdevice
ㅤㅤㅤㅤㅤㅤㅤㅤ˚₊‧꒰ა 𓂋 ໒꒱ ‧₊˚
Click the green text → directly sent to my strawpage.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Rating some Whippa ships i found in the fandom:-
(Note: self and oc ships not included)
1- Qhippa (Quinn x Whippa)
Art by @watercat72 on tumblr
6-7/10
I kinda see it but not my cup of tea. I think police and law people would dislike the duo because of how they got away from what they did.
2- Whiplee (Whippa x Koilee)
Art by @koriloveswhippa on tumblr
11/10
MY FAVORITE ONE. I think their chemistry is cute and I wanna get rid of my writers’ block to do something for them.
3- Whipjoy (Whippa x Joy) (both alter egos included)
Both Arts by @muddaisy on tumblr
7.5/10
The ship kinda ate ngl. But I prefer the canon joymoe (sorry).
4- Whippa x Janana (not sure if it’s a ship but I’ll include it anyways)
Art by @cluelessthecoolest on tumblr
5.5/10
I don’t see it.
5- Whippa x (Mitch, Hacky Zak, and Gremmie)
Post by @alaskacoolkid1 on tumblr
3.5/10 with Zak and Gremmie
4/10 with Mitch
I don’t believe in straight Whippa. But some bonus point for Mitch because I think the ship dynamic would be funny.
6- (Whippa x Prudence)
Edit by @reecesplotdevice on tumblr
6.5/10
The ship might be cute opposite attracts but I like cooper x prudence more.
7- Doan x Whippa
Photo by @chloe_butterberrys on instagram
2/10
No
Doan is a real person and again I don’t see Whippa with a man.
8- Whippa x Gabitha
8.5/10
Interesting a bit too much.
It’s just my opinion.
If there are any more Whippa ships, tell me about it/them.
And Mousse x Whippa sibcest shippers, GET THE FUCK OFF.
I just saw this now hello?? Uhmm thanks for the credit because there are people in this community who wouldn't be decent enough to do so.
but I immediately saw the mention of coopdence and I would like to mention that I have that ship on my dni and I'm more of a mousse x cooper, so if you're gonna interact with my work, sorry. Atleast your honest with the rating I guess. No offense given or taken.
For my Sonadow lovers💗💗

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Stop liking the fucking original now. Fucking bitch.
May I ask why you have GCTAGCTAGCTAGCTAGCTACTGA in your banner? Who's DNA is that.
It's a filter under the object category in Glitch Lab, which I used for my layout :)
Note: Mode was where I got the specific one for my banner
Remember that chart I made last year? Here's the uploaded version lol
Lemme know when we get the 3d renders of the cowboys
#sonadow
It's my 2 year anniversary on Tumblr 🥳
2 YEAR ANNIV 6 DAYS AGO I JEEP FORVETTING MY TUMBLR HI

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Silent Hill 2, 2001
Freakazoid2000
I accidentally drew 6 fingers on his left hand and I didn't notice after I literally posted it to two of my sps focused socials. This one is edited to remove the accidental extra finger so do NOT CANCEL ME FOR AI!!!!!!!!!!!!! 1!!!!!! 1! 11! 1! /JOKE
me when im the fast and furious swan boat (flamingo)
art trade with @reecesplotdevice
Dude...... Hell yeah.............
What do you mean I forgot to post this before posting the cookie kitsunes.
Anyways, old wip from March I decided to finish

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
I kept avoiding having to draw these dudes as cookies but now. Its done.
On the topic of cookie bb boys, I might redraw the first one I did, since they didnt really look like the crk style at all. They're pretty ugly yet theyre my top post on this account and on my twitter where volks va commented on it (and xianyuns va liking it)
Anyways, I made a gdrive w all of the sprites of them transparent here
New bb cookie art when new guys drop or a pf boy becomes dateable. Who knows ❓
The sight of you dead, I'm so glad it's over now
BRIGHT COLOR CW BELOW
Lyrics: