Girls, if you're self-conscious about the way your tum and thighs jiggle when you walk, you need to know that you have unimaginable power over the rest of us creatures beneath you
What if I'm not self conscious about it?
Today's Document

Discoholic 🪩

Andulka

Janaina Medeiros
cherry valley forever
Three Goblin Art
taylor price
Peter Solarz
Cosimo Galluzzi

roma★

if i look back, i am lost
tumblr dot com

★
AnasAbdin


sheepfilms
will byers stan first human second
seen from Canada

seen from United States

seen from Italy
seen from United States
seen from United States

seen from United Kingdom

seen from United Kingdom

seen from Malaysia
seen from Russia
seen from Germany
seen from United States

seen from United States

seen from Malaysia

seen from Malaysia

seen from Malaysia
seen from United States

seen from United States
seen from United States
seen from United States

seen from United States
@mxamalgam
Girls, if you're self-conscious about the way your tum and thighs jiggle when you walk, you need to know that you have unimaginable power over the rest of us creatures beneath you
What if I'm not self conscious about it?

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Little miss whos shy until she trusts you then she becomes the biggest slut on the planet.
Social media kinda sucks. I'm gonna go now
umm i need reassurance that my presence is wanted but i can’t ask for reassurance because that’s really Embarrassing and it wouldn’t feel genuine if i asked for it
Reblog to let prev know their presence is wanted
Aliko Dangote, the richest man in Africa, has been tormented by a Brazilian man named Osvaldo for the last several years.
Aliko is not taking it well
fucking love this story
#go osvaldo go
"Brazil from an altitude of 4 feet" fucking sent me
like. at first it was "yeah that's pretty funny but i can see how it would get overdone and just be annoying especially when you're trying to share interesting things" to "holy shit why are you threatening this person over silly shitposts"

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
"don't go grocery shopping when hungry" doesn't work for me because Not Hungry Me cannot conceive of a universe in which food is needed so she buys like a cup of pomegranate seeds and some fancy cheese and thinks that'll get us through the week.
FUN FACT the scientist who said that made it the fuck up! he's also the same dude who said that if kids made eye contact with the character on food boxes they wanted it more. so now all the cereal mascots/kids mascots look downwards to a child height. but THEY MADE IT UP and it's allllllll bullshit and bad science to the point cornell deleted the fuckin cereal eyes study from the face of the earth and modern research is saying you SHOULD shop when ur hungry because it makes you put more value on food that would give you more nutrition and actually sharpens your ability to feed yourself well
So I think the cereal box guy was Brian Wansink and honestly that tracks. If Wansink thinks we should be grocery shopping when full then we should definitely be doing it when hungry. Bruh is an absolute joke.
THAT'S THE BASTARD
IT'S HIM
imagine being so bad at science that your university forces you to stop
things he also came up with that are BULLSHIT:
eating around fat people makes you eat more junk food??? (wtf?)
portion sizes affecting how hungry you feel
"if you are served second portions you are more likely to take seconds"
the entire concept of mini and fun-sized portion sizes (based in fatphobia btw!)
the idea of boredom eating and stress eating being bad for you and not normal
the idea of eating in front of a screen being terrible for your digestion
that julia child's cooking was trying to make you fat (based on 18 of 4500 recipes...)
the idea of western food being unhealthy
the cereal eyes thing
the shopping while hungry thing
and much much more!
also he committed kickstarter fraud in 2018 and is a massive fatphobe who thinks fat people recruit others to become fat by just existing. fuck him lmao
Brian Wansink won fame, funding, and influence for his science-backed advice on healthy eating. Now, emails show how the Cornell professor a
Cornell University food behavior scientist Brian Wansink has retracted another paper — his fourth this year. “There is no empirical support
Cornell University scientist Brian Wansink is facing yet another formal correction — his eighth this year, along with three full retractions
Brian Wansink of Cornell University publishes headline-friendly studies about food psychology and oversees a $22 million federally funded pr
Here's a few articles by Stephanie M. Lee about Wansink's multiple p-hacking scandals. Initially I just found these looking for more information but now I'm also extremely amused by how much she was on this guy's ass for his shitty science.
Maintenance Phase also did an episode on this guy
When you first learn about Brian Wansink, he's an extremely funny example of a BAD scientist.
When you think longer about Brian Wansink, the fact that he got so much media attention and many people know his lies but not the retractions, the fact that he was able to spread flagrant fatphobia with hardly any pushback for so long and the fact that there were policies based on his bullshit, is horrifying.
White man makes up a bunch of stuff designed to make people go "Yes, that fits into my framework of thought. Integrating that now." And achieves fame for it Number #283809283
"You can't ship that!"
lol what are you gonna do, climb inside my mind and shut off the imagination switch?
This kind of response always fascinates me, so while I've got you here, can I just ask: legal by what standards? Do you mean real world standards, where laws vary from country to country, and in the case of the US, state to state? Or do you mean the fictitious laws set in place in the fictional setting of the ship? What standard exactly should we use to tell people "you're not allowed to enjoy this fictional thing?"
I know you didn't mean any harm by your response, but I feel it's important to reiterate that nothing gives anyone the right to police what people do in a fictional setting, full stop. Because at the end of the day, it's fiction, it's a fantasy, none of it is real, and so real world rules and standards do not apply. So, as long as you are not actively causing harm in a real world setting (i.e. harassing real people over fictional ships) then you do you.
a very important addition
Something that also drives me NUTS with this "uwu if it's legal" shit is like...
Y'all only EVER. Say it about sexual stuff. "Oh wow well if it's LEGAL-!" bitch my ass is out here playing DnD. I roleplay a devil-them who KILLS PEOPLE FOR A LIVING and yet I don't see y'all rushing to tell me that those thoughts are illegal and bad and noooo you can't do THAT, murder is ILLEGAL.
It's because y'all are a bunch of puritan weirdos about sex and I reblogged a post that hits why right on the nose but dear FUCK y'all need to really unpack all of your weirdness about sex. Like. Right now. Because it's all conservative bullshit.
Silly Game Time: WRONG ANSWERS ONLY! How do you win a football game?
Put the ball up your ass and run to the goal. Gets them every time.
I've never had to deal with credit scores, I don't even know if it's a thing where I live. But yeah, everything I hear about it makes it sound like a horrible dystopian scam.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Star Trek: Deep Space Nine "Past Tense, Pt. 1"
Reblog if it's the same year as it was yesterday, 2024
oh, so you like dogs? name one dog
this is the dog, you can name them :)
How would you die in Willy Wonka’s chocolate factory?
this is a great question because it narrowed my soul! i would choke on regular chewing gum on the steps outside before even entering the factory. willy would make no attempt to perform the heimlich maneuver and would leave my corpse on the concrete
String identified: accatacttagattcatacgacggttttgtactaatttttcaaactcctcgccgtagtaatctacatacatatatttagaacgaatacatatatataat
Closest match: Eutolmus rufibarbis genome assembly, chromosome: 1 Common name: Robber Fly
(image source)
Awesome
mlp movie review
I mean, I didn't need any additional inspiration to work as hard as I can to elect Kamala Harris, but if you say so...

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
I understand why a lot of fantasy settings with Ambiguously Catholic organised religions go the old "the Church officially forbids magic while practising it in secret in order to monopolise its power" route, but it's almost a shame because the reality of the situation was much funnier.
Like, yes, a lot of Catholic clergy during the Middle Ages did practice magic in secret, but they weren't keeping it secret as some sort of sinister top-down conspiracy to deny magic to the Common People: they were mostly keeping it secret from their own superiors. It wasn't one of those "well, it's okay when we do it" deals: the Church very much did not want its local priests doing wizard shit. We have official records of local priests being disciplined for getting caught doing wizard shit. And the preponderance of evidence is that most of them would take their lumps, promise to stop doing wizard shit, then go right back to doing wizard shit.
It turns out that if you give a bunch of dudes education, literacy, and a lot of time on their hands, some non-zero percentage of them are going to decide to be wizards, no matter how hard you try to stop them from being wizards.
It wasn't just the hoity-toity ritual magic stuff, either. Popular media often frames a fundamental opposition between the Church and practitioners of the Old Ways™, but on the ground, any given medieval European community's foremost practitioner of traditional folk magic was likely to be the village priest. And again, they very much were not supposed to be doing this. There were some very pointed letters going around reminding people to cut that shit out, not that we're naming any names, Jeremy, and no, "if you invoke the saints first it's fine" is not going to fly with the bishop.
You shouldn’t date or become serious friends/partners with someone if you can’t stomach the thought of being stuck in a car or train with them for 16 hours.
Here’s my logic:
You should be able to work together to solve unexpected problems like fixing a flat tire or getting lost in an unfamiliar station
You should feel comfortable and safe enough around this person that you can sit in comfortable silence
You should be able to keep each other interested and deal with each others boredom in a healthy way
If you’re gonna form a long term partnership with someone you should probably be able to tolerate each other while locked in a small box for a few hours
These tags are hilarious even though I don’t think you intended them to be.
*pulls European closer* The most populous countries in the world are China, India, the United States, Indonesia, Pakistan, Nigeria, and Brazil in that order, with these seven nations alone making up 48.16% of the world population. You may note with the aid of a map that many of these nations are quite large, and would take several days of travel to go across either in cars or on boats. Almost half of the world's population lives in places where you can travel in a cramped vehicle for days and still be within the country. Your worldview is limited and Europe is a tiny outlier in travel time and standards for international relations.