Help spread the word: Obamacare deadline for health care coverage in 2019 is December 15. Pass it on.
will byers stan first human second

blake kathryn
he wasn't even looking at me and he found me
styofa doing anything
Aqua Utopiaļ½ęµ·ć®åŗć§čØę¶ćē“”ć
One Nice Bug Per Day
Jules of Nature

ellievsbear

JBB: An Artblog!

Game of Thrones Daily
AnasAbdin

Kaledo Art

Kiana Khansmith
Claire Keane
occasionally subtle
todays bird
taylor price

Andulka
dirt enthusiast
seen from Mexico
seen from Malaysia
seen from Mexico

seen from Costa Rica
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States

seen from United States

seen from United States
seen from United States
seen from United States
seen from United States

seen from Brazil

seen from Saudi Arabia
seen from United States
seen from United States

seen from United States
seen from Uzbekistan
@donkeymkong
Help spread the word: Obamacare deadline for health care coverage in 2019 is December 15. Pass it on.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
Reblogging this once more because my mom and I legitimately laughed to tears.
this is my favorite video on the internet
mental health tip: save this video. watch it when youāre sad. itās the best goddamn thing on the internet
Does anybody remember this āgo nuts, show nuts, whateverā gem? Oh how the mighty have fallen.
You either die a hero or live long enough to see yourself become a villainĀ
Incase anything happens to my account hereās my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGā¦
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
THIS IS THE WORST THING
If thereās anything worth living for, itās kittens trying to imitate their moms.
PEAS š¦
thank you so so much for sharing this. this video is so important to me. i would sell my laptop, my house, and my sister for this duck. this video has enlightened me. i can continue living knowing such a being exists. thank you.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
i just went on r/incels to see if it was really that bad and it was actually pretty informative. i found out that women are all powerful beings and we control society by exploiting men for their money and their jobs,Ā are NOT required to pay bills, and that we all make 50k a month on patreon. like shit why did no one tell me. i didnt even know i had a patreon
my grandmaās watching fox news and iām overhearing then losing their absolute shit over millennials not buying kraft singles
letās be real though, it deserves to die.
it doesnāt taste anything like cheese.
Its not even allowed to be branded as ācheeseā in most countries outside the US
Mess
This is justā¦nah, this aināt right.
this is grindr. why are you all so surprised?
Reblogging mostly for the Yzma gif.
an actual video of me in any math class ever.
crying at what someones tagged this
glaswegian ya fool

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
Hans Hemmert
this feels like a furry thing
āhey bro whats your fursonaā āvague yellow massā
itās not implausible and you know it
powerful energies to ward off negativity in 2018