dumb idea

if i look back, i am lost

JVL

gracie abrams
we're not kids anymore.

#extradirty

Love Begins
trying on a metaphor
Keni


bliss lane
Today's Document

tannertan36
I'd rather be in outer space 🛸
wallacepolsom
Cosimo Galluzzi
noise dept.
tumblr dot com
let's talk about Bridgerton tea, my ask is open
Sade Olutola
seen from Brazil
seen from Brazil
seen from United States

seen from Argentina
seen from United States
seen from United States
seen from United States
seen from South Africa
seen from United States
seen from United States

seen from United States
seen from Germany
seen from United States

seen from United States
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from United States
@syalassora
dumb idea

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
The fact that someone made this whole account specifically for this one joke. My hat is off to you.
yeah okay, ill reblog that!
do you think you have more men or women followers?
Only women follow me, because they can sense my gentle, deer-like aura
How would you die in Willy Wonka’s chocolate factory?
this is a great question because it narrowed my soul! i would choke on regular chewing gum on the steps outside before even entering the factory. willy would make no attempt to perform the heimlich maneuver and would leave my corpse on the concrete
String identified: accatacttagattcatacgacggttttgtactaatttttcaaactcctcgccgtagtaatctacatacatatatttagaacgaatacatatatataat
Closest match: Eutolmus rufibarbis genome assembly, chromosome: 1 Common name: Robber Fly
(image source)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
was at the local watering hole when the news broke and a random guy looking at his phone went "wow!" so i asked "trump?" and he said "no, new species of tiger beetle"
New species of tiger beetle discovered today, named Eunota Houstoniana, named after the Houston TX region it lives in.
This beetle actually gravitates TOWARD salt-heavy soils and oil extraction sites!
Once my boyfriend told me: "You're not a burden. A burden is something you're forced to carry against your will. I freely choose to be a part of your life and that means you aren't a burden to me." I'm passing it on in case some of you need to be reminded of that.
You know who you are and I fucking love you okay. I would kill god with you because it means I get to help you.
RAAAAAAAAH!!!!!!!!!!!!
transmasc : if you were a girl who pretended go be a wolf as a kid congrats on your transition lol
everyone on this site :
transfem : my cis guy friend reminds me of me before i came out haha
everyone on this site : hey umm ... lets not normalise pressuring gnc men to transition .. ?? youre just bringing back gender essentialism and its really gross tbh . what happened to letting men be feminine ?
Reblog to open a rail line from your blog to the person you reblogged this from
our beautiful rail line... (so far)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Comparing spicy food to domestic violence...bad take lol. Why is a man beating you so he can orgasm better than beating you in general? It's worse. If a man slits your wrists because you asked, is that OK? You people are mentally ill.
A radfem in my inbox? Who didn’t bother to read my blog before messaging me? On anon, no less? What a surprise. Alright, let’s dance: I’ll point out your small mistakes before we move on to the big one 🖤
1. I’m a dominant. Nobody is beating me, unless, of course, I order them to.
2. I’m a lesbian. No man is coming near me, let alone COMING near me. Gross.
Alright, now that that’s out of the way: your concept of what BDSM is appears to be sadly informed only by Fifty Shades (Powerful Man Hits Helpless Woman!!!) which is… not reflective of the realities of this lifestyle. “Negotiation,” or talking to a potential partner about what you both want, is a bedrock of these relationships. You can find plenty example of yes-no-maybe checklists on the internet or in books—it’s quite common for partners to fill out a checklist of this type and compare them. Anything that anyone has marked “no” on is off the table-
“But wait!” you say, as I mention consent, “Men don’t care about consent! Men watch violent porn and reenact it on women! Men prey on women who are seeking BDSM relationships in order to abuse them!”
Well. Yeah. You’re right. This is not because of some innate evil in BDSM. This is because our patriarchal culture is built on male entitlement. Like… come on. I will point you to one of your own philosophies, the rules of misogyny, and I will speak to you in your own language:
I, a dyke, who is fascinated by the intersection of pleasure and pain and have been incorporating it into my sex life since it began, have nothing to do with men abusing women in any context. Period. What I do with other lesbians does not perpetuate male violence. Males perpetuate male violence. I KNOW you know this. Do not waltz into my inbox pretending ignorance. I will not pretend ignorance either: BDSM is risky on its own, and that risk increases exponentially for women who seek male partners in the scene. I love those women and do what I can to protect them. I will not, however, change my approach to sex or my general hedonistic philosophies just because men use BDSM to hurt women. If I never engaged with anything a man has used to hurt a woman, I would spend my life doing a whole lot of nothing.
Alright, that’s quite enough of that. Back to negotiation and consent: As a dominant, I’ve found that much more of my time is spent being told a submissive’s dangerous fantasies, and figuring out how to take them as close as I can get them to their desires without actually hurting them. Choking (or, more accurately, strangulation) is a great example of this. Many submissives actively desire that helpless feeling, that light-headed euphoria. I, however, do not want to kill any of my beloved’s precious braincells. So we negotiate, experiment, and find ways to achieve what they want without doing anything that I mark as too dangerous. But that’s just one example: any potential act is discussed in detail before a scene begins. Either partner gets to say no to anything during these discussions, and during sex as well, just like in vanilla sex.
My spicy food metaphor was silly, but it has a grain of truth to it—things that hurt can feel good, too. Contact sports, roller coasters, skydiving or BASE jumping, bouldering or ice climbing, even running marathons, are all things that are scary, painful, dangerous, or carry risk. Humans do them anyway. We love doing them. I love doing them. And you are not going to change my mind by strawmanning in my inbox. See you around.
i wouldn't ask you (think i could be all you dreamed)
Arcane (League of Legends) Caitlyn/Vi (e, 1/1, 6.8k words)
“Sorry, cupcake, didn’t know where else to go.” It’s more or less the truth. Vi didn’t know how she climbed out of the undercity at this hour, all she had known was that no one down there was going to help her and there was someone in Piltover who would. It was strange, to need help in a town she used to know so intimately and not have a single person to stitch her up, but sometimes that’s just the way it goes. Either way, she’s at Caitlyn’s door now.
Long after they had met, Vi and Caitlyn began to sleep with each other. It was a casual affair, all flesh and tongues and desperation. It was nothing, two sort-of-maybe friends blowing off some steam. Until it became more than it should have been and Vi couldn't take it. Months later, she's bleeding out on Caitlyn's doorstep. Funny how things work out this way.
read here
Caitvi shit from my fave wolfwren author? The stars have aligned. This is some good shit, Vi fits this trope so well with Cait
Finally all caught up. Day 14, 15, and 16 of drawtober.
How old were you when you got your first job?
13 or younger
14
15
16-17
18-19
20-21
22-23
24-25
26 or older
I do not work / I still have not gotten my first job
Please add in the tags where you're from too I'm very curious
From the two Norwegian responses I've had so far I am either getting a warped idea of what age most people are when they start working there or the average genuinely is 25
Ok let's go the nordic beef has already started in the notes
Ok damn the Swedes aren't holding back I see
I am deeply sorry but I am kind of losing my mind over "professional orphan"

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Leaning on others is one of the strongest things you can do. You are not a burden.
hope 2023 brings everyone lots of lesbian sex
hope 2024 brings everyone lots of lesbian sex