This is the best ad I've gotten since they added the Tumblr Blaze feature thank you tumblr user plaguerightsactivist for using this new feature correctly
One Nice Bug Per Day
Monterey Bay Aquarium
hello vonnie

YOU ARE THE REASON
official daine visual archive
RMH

Jar Jar Binks Fan Club

oozey mess
will byers stan first human second
todays bird

shark vs the universe
tumblr dot com
h
𓃗
EXPECTATIONS
Cosmic Funnies
macklin celebrini has autism
seen from Austria
seen from China
seen from Lebanon

seen from United States

seen from United States

seen from Netherlands
seen from Qatar

seen from Kenya

seen from United States
seen from United States

seen from Ecuador
seen from Philippines

seen from Türkiye
seen from United States
seen from United States

seen from Netherlands

seen from Türkiye
seen from United States

seen from Türkiye
seen from United States
@ryzes
This is the best ad I've gotten since they added the Tumblr Blaze feature thank you tumblr user plaguerightsactivist for using this new feature correctly

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
by will mcphail
iT's fUnY beCAusE mEn aRE DumB
No dumbass, it's funny because women are usually left out of these pictures. And most of history. While actually, you know... living full lives and contributing to society. Just like men do. But men are always in the fucking picture.
This isn't a comic about men being dumb, it's a comic about women being forgotten, ignored, and excluded. But you were so ready to be pissed at mean feminists that you took something personally that absolutely wasn't and got offended by something that wasn't being said.
The artist was a man but women still got blamed for the “misandrist joke” by a redpiller calling himself a “big dick americhad“
i love this dude he’s made a bunch of other ‘misandrist jokes’ as well
poisons you with a poison that works immediately
oh my god i feel it immedia
poisons you with a poison that works immediately
oh my god i feel it immedia
thank you for sending assassins after me btw i really needed that. it meant a lot to me

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
tumblr dosent count as social media
tumblr counts as a terrarium
you know, the more I think about it, I don't think there were ever any "Russian spies" or "Russian chaos agents"
I think those were just normal tumblr blogs bro
Just found out what sea shanties is... I thought it was this thing
i think i will become a creature.
*scuttles*

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
my best feature is that I'm blindingly intelligent for about 30 seconds a day
I do not get to choose which seconds. they are not consecutive
slept in today, what’d I miss?
go back to bed
Satan tempting Jesus in the desert
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
sounds like someone is a little TOO mentally ill… goodbye!
Hiring managers