Everything And Anything @marvelouskrys - Tumblr Blog

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

mysieee

*insert Spiderman pointing at Spiderman meme*

mcu-but-its-vines

Loki: *Pulls a knife*

Thor: oh no

Loki: *Opens a cardboard box with the knife*

Thor: phew

Loki: *Pulls a gun out of the box*

Thor: oh no

babyanimalgifs

mcucaps

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

dekoi2501post

spectregoesboo

taronzegerton-archive-deactivat

random gifs of tony stark: 15/??

birdship

so that post about how you can get around the bot by tagging things “#sfw”? uhhhhh it’s TRUE.

i did a little test in my drafts:

i am losing my goddamn mind like how is it possible to be this stupid

tin-pan-ali-deactivated20191216

in a fascinating and asinine twist, we must now tag NSFW as SFW

mwg-drwg

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

monkeysky

You got like six unique nucleotides so nice

deepspacepirate

OP is a virus from outer space

deepspacepirate

FUCK YOU OP

robertdeniro

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

un-magnificentlivesofadults

My mom just sent me this picture of my dog…I guess we got a lot of snow, then

un-magnificentlivesofadults

update:

back-that-sass-up

Great update

jeonjeha

Avengers: Endgame + The 5 stages of grief.

aslightstep

‘Who is going to save Tony?’

Well, historically: Tony.

officialwhitegirls

me as a firefighter: *blasts burnin’ up by the jonas brothers on the aux cord instead of turning on the siren*

hobrien

Once Upon a Deadpool (2018)

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

whatthefuuuuuuccckkkk

the way americans are obsessed with the fuckin military is terrifying. I work as a cashier so I occasionally have to ask for donations for whatever the cause of the moment is. people will donate all the fuckin time to the troops but not only will they ignore homeless children, but they joke about it. they’re over here like “haha I have my own hungry children to feed” or “they should be donating to me I’m hungry” or other just straight up stupid unnecessary shit and it’s cruel, joking about homeless fuckin children. yet the mere mention of troops and they’re throwing all their money at me. these people are glorified murderers and americans eat that shit up and worship the ground they walk on. the brainwashing is un-fuckin-real

strangelyiron-deactivated202012

one taught me love

one taught me patience

one taught me pain

and one is gonna fucking put me in cardiac arrest

Trending Blogs

Last Seen Blogs

Everything And Anything