Something in the wind has changedāit calls you by a different name.
2025 on Tumblr: Trends That Defined the Year

romaā
tumblr dot com
i don't do bad sauce passes

Product Placement

JVL
Keni

⣠Chile in a Photography ā£

Cosimo Galluzzi
h
$LAYYYTER
we're not kids anymore.
KIROKAZE

Kaledo Art
One Nice Bug Per Day
Peter Solarz
YOU ARE THE REASON
I'd rather be in outer space šø

seen from United States

seen from Poland

seen from United States

seen from Malaysia
seen from United Kingdom

seen from Poland

seen from Japan

seen from Singapore

seen from Malaysia

seen from Singapore
seen from United States

seen from United Kingdom
seen from Mexico
seen from Poland

seen from United States
seen from United States

seen from United States
seen from Argentina

seen from Malaysia
seen from Türkiye
@lightchasing
Something in the wind has changedāit calls you by a different name.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
Hope my roommate likes this lol
one round/action in D&D is 6 seconds so anything you could accomplish during a vine you could do during your turn
Rogue: āIām back at it again at Krispy Kreme.ā
DM: āRoll an acrobatics check.ā
Fighter: I want to see my little boy
DM: roll a perception check
*nat 20*
DM: here he comes
bard: toss me my keys
*rolls a 1*
DM: i thought you said printer
Fairy: I still havenāt found my berries
DM: roll a perception check
*rolls a 9*
Fairy: BUT! *holds up an orange* I found this.
Druid: I am the sand guardian, guardian of the sand.
DM: Roll an intimidation check.
*nat 20*
DM: Poseidon quivers before him!
Druid: Fuck off!
Dm: can you read this for us?
Fighter: rolls a nat 1
Fighter: what up im Jared im 19 and I never fuckin learned how to read
Fighter: Itās summer, I got my helm on backwards and itās time to fuckinā party.
DM: Roll for Dodge.
Fighter: *rolls a 1*
Fighter: *slams head into ye olde portcullis*
I canāt actually even process how bad this is. I logged of for the 17th and came back to find out 6 porn bots had followed me while I was logged out
jmdragunas

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
Wolfie the Werecat and his wonderfulĀ Enchanted Forest Kitty Sanctuary.
Photos by Wolfie
Cat Tree made byĀ Hollywood Kitty Company
@molosseraptor
Itās everywhere!
Everything about this is a dream come true.
*slams back a bourbon whiskey* listen mate Iāve been here for all kinds of ridiculous tumblr meltdowns I was here when Yahoo took over I was here for dashcon I was here when the notes disappeared I was here back when those superwholock chain posts of fucking up non believers were taken seriously and through every single one I have done fuck all. I have not changed a goddang thing. I waited for the end and the end never came. I do not plan on changing my status quo now. either things will go on as they always have and in six months time Iāll be here watching staff announce that anyone with over 1000 followers are being monitored or I will have been physically deleted from this wonderful stupid fucking website and either way Iām gonna go out posting pictures of my cat
???????????????
this is how bad it is
i told yall the review process is *also* automated lmfao
T-Those are mushrooms
sexy, sexy mushrooms
my favorite sport is jousting. except without the pole because thats too dangerous. just riding my horse angrily towards another guy riding a horse angrily, that is my passion

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
theyāre getting rid of custom themes????
yāall deadass?
if I see anyone posting anything that isnt catholic stained glass photos after the 17th Iām reporting you to the staff on sight
Incase anything happens to my account hereās my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGā¦
DO ONE THING EVERY DAY THAT SCARES YOUR FAMILY
female-presenting nipples

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch ⢠No registration required ⢠HD streaming
truth coming out of her well to shame mankind (tumblr safe version)
āfemale-presenting nipplesā