layla @goodkingmog - Tumblr Blog

x

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

dumblesbianjockenergy

every Breath of the Wild cutscene summarized:

someone: expressing deep and heartfelt emotion

Link:

master-painters

Ferdinand Hodler - Dents-du-Midi - 1912

bagelriri

cupcakKe photographed by Luke Gilford for V Magazine, 2018

joshmuratori

neo-soulless

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

clearslime

nemfrog

Toads. Exploring nature with your child. 1952.

willard-metcalf

Spring in the Valley, Willard Metcalf

https://www.wikiart.org/en/willard-metcalf/spring-in-the-valley

thejakelikesonions

Death before sticky hands

hiest-moved-deactivated20190716

have y’all seen that nasa pic of the earth with the sun behind it on the night time side it really really fucked me up my own soul became solid and like………….. weeped!

hiest-moved-deactivated20190716

who wouldn’t see this and then look deeply into their own emotional playing field to see what improvements could be made purely inspired by the vulnerable earth. this is the face of all literal gods

greycloudsandlinings

That’s actually called the Overview Effect- something experienced by some astronauts that makes them see that “from space, national boundaries vanish, the conflicts that divide people become less important, and the need to create a planetary society with the united will to protect this “pale blue dot” becomes both obvious and imperative”.

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming

mwg-drwg

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

nemfrog

“Moon’s shadow on the earth, as seen from the moon.” A study of the sky. 1896.

papillon-de-mai

John Singer Sargent — Mrs. Abbott Lawrence Rotch. detail. 1903

bintilleil-deactivated20200510

living in a class society… im over it

vicevirtue

ryan gosling playing YOU? ridiculish………….

•18+ Adults Only

Watch Anya Live on Cam

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.

✓ Live Streaming✓ Interactive Chat✓ Private Shows✓ HD Quality✓ Free Actions

Free to watch • No registration required • HD streaming