Ask questions. Piss people off. “I don’t know what you’re fucking talking about.” That’s your job.
Calculus Professor, after asking if anyone had any questions and no one raised their hand (via mathprofessorquotes)

#extradirty

祝日 / Permanent Vacation
taylor price
DEAR READER
KIROKAZE

⁂
Mike Driver
I'd rather be in outer space 🛸
Claire Keane
sheepfilms
Sweet Seals For You, Always
$LAYYYTER

d e v o n
Show & Tell
Alisa U Zemlji Chuda
Sade Olutola
AnasAbdin
will byers stan first human second

seen from United States

seen from United States
seen from United States

seen from United States
seen from United States

seen from United States

seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States
seen from United Kingdom

seen from United States
seen from Germany

seen from Türkiye

seen from China
@fishmmilk
Ask questions. Piss people off. “I don’t know what you’re fucking talking about.” That’s your job.
Calculus Professor, after asking if anyone had any questions and no one raised their hand (via mathprofessorquotes)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
WHAT YOU HAVE HEARD is true. I was in his house. His wife carried a tray of coffee and sugar. His daughter filed her nails, his son went out for the night. There were daily papers, pet dogs, a pistol on the cushion beside him. The moon swung bare on its black cord over the house. On the television was a cop show. It was in English. Broken bottles were embedded in the walls around the house to scoop the kneecaps from a man’s legs or cut his hands to lace. On the windows there were gratings like those in liquor stores. We had dinner, rack of lamb, good wine, a gold bell was on the table for calling the maid. The maid brought green mangoes, salt, a type of bread. I was asked how I enjoyed the country. There was a brief commercial in Spanish. His wife took everything away. There was some talk then of how difficult it had become to govern. The parrot said hello on the terrace. The colonel told it to shut up, and pushed himself from the table. My friend said to me with his eyes: say nothing. The colonel returned with a sack used to bring groceries home. He spilled many human ears on the table. They were like dried peach halves. There is no other way to say this. He took one of them in his hands, shook it in our faces, dropped it into a water glass. It came alive there. I am tired of fooling around he said. As for the rights of anyone, tell your people they can go fuck them- selves. He swept the ears to the floor with his arm and held the last of his wine in the air. Something for your poetry, no? he said. Some of the ears on the floor caught this scrap of his voice. Some of the ears on the floor were pressed to the ground. May 1978
-Carolyn Forché, “The Colonel”
[All lines from “The Colonel” from The Country Between Us by Carolyn Forché, Copyright © 1981 by Carolyn Forché.]
Energy Management
A human-based organization method
click on images for better resolution; images also available here (link to google drive)
Other posts that may be of interest:
Getting stuff done: How to deal with a lack of motivation
Flexible time-blocking: A more breathable way to get things done
The ABCDE Method
#I know this gets thrown around a lot but:#shorts that say this on the ass -fictionalfix
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Keith S. Wilson’s poem “Heliocentric” is ostensibly a love letter from an astronaut to someone back on Earth. But along the way, you realize it’s really more of a love letter to space itself—to the whole universe. I promise I still dream / of coming back to you, he says. But the moons over Jupiter. But / asteroids like gods. If someone sent me this letter from space, I’d be pissed. As a reader—especially now, stuck in quarantine and feeling dreamy—I’m enchanted. [x]
can we talk about flowers as a symbol of love and peace and specifically gay love and peace pls…..
an interview with kathee muzin about the first time she fell in love with another woman, 1991 // san francisco pride, 1978 // the book of delights, ross gay // les fleurs, minnie ripperton // subway hands // fragment 94, sappho trans. gillian spraggs // moomins, tove jansson // she changes the weather, swim deep // imagine me & you, 2005
looking at old photos of myself thinking not only is that girl dead but i killed her
i love paleolithic art. there’s something really beautiful about learning how the caves were painted; the time it took for the artists to make their colors, the method of spraying paint through bones or through lips for application, the care in linework and perspective. there is nothing rudimentary about paleolithic art, nothing to be looked down upon from the pulpit of modernity. people built scaffolds to reach cave ceilings and made fires to paint by, they traded with other people for materials to better their art and used the irregularity of the rock face to bring their animals to life. paleolithic art was intentional and treasured. whether they meant to weave tales or remember their pasts, to honor the world surrounding them or worship old gods, it meant something. i think it can mean something now too
dalton day

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
from “sometimes i wish i felt the side effects” by Danez Smith, Poetry Magazine March 2018
Window Opening on Nice - Raoul Dufy
the light in these illustrations by Kyuate Lee is everything ✨
idk abt u but one day. one day i am going to share an apartment with friends and were gonna hang out together like this every sunday night .

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
saying “i dont find conventional attractiveness attractive” just sounds like im trying to be the most Enlightened and Progressive person in the room but its like, its not even trying to be a statement bc conventional attractiveness is so lacking in humanity
like… clear skin, clean shaven, manicured faces, an uncomfortably starved physique, and (if a woman) the expectation of elaborate and time consuming makeup for the sole purpose of removing all human flaws, shaved arms and legs, invisible pores, etc etc.
its so unsexy. its like… the body as a minimalist rich person house or a flawlessly manicured suburban lawn. its a performance and not lived in.
everyone is beautiful and no one is horny goes into this in a way i really liked. some quotes:
Actors are more physically perfect than ever: impossibly lean, shockingly muscular, with magnificently coiffed hair, high cheekbones, impeccable surgical enhancements, and flawless skin, all displayed in form-fitting superhero costumes with the obligatory shirtless scene thrown in to show off shredded abs and rippling pecs. And this isn’t just the lead and the love interest: supporting characters look this way too, and even villains (frequently clad in monstrous makeup) are still played by conventionally attractive performers. Even background extras are good-looking, or at least inoffensively bland. No one is ugly. No one is really fat. Everyone is beautiful. And yet, no one is horny. Even when they have sex, no one is horny. No one is attracted to anyone else. No one is hungry for anyone else.
In the films of the Eighties and Nineties, leading actors were good looking, yes, but still human. Kurt Russel’s Snake Plissken was a hunk, but in shirtless scenes his abs have no definition. Bruce Willis was handsome, but he’s more muscular now than he was in the Nineties, when he was routinely branded a bona fide sex symbol. And when Isabella Rosselini strips in Blue Velvet, her skin is pale and her body is soft. She looks vulnerable and real.
[about Poltergeist] The house looks real, too. There are toys and magazines scattered around the floor. There are cardboard boxes waiting to be unpacked since the recent move. Framed pictures rest against the wall; the parents haven’t gotten around to mounting them yet. The kitchen counters are cluttered and mealtimes are rambunctious and sloppy, as one expects in a house with three children. They’re building a pool in the backyard, but not for appearances: it’s a place for the kids to swim, for the parents to throw parties, and for the father to reacquaint himself with his love of diving. At the time, this house represented an aspirational ideal of American affluence. Compare this to homes in films now: massive, sterile cavernous spaces with minimalist furniture. Kitchens are industrial-sized and spotless, and they contain no food. There is no excess. There is no mess.
Kate writes, “The inside of McMansions are designed in order to cram the most ‘features’ inside for the lowest costs.” These features exist to increase the house’s resale value, not to make it a good place to live. No thought is given to the labor needed to clean and maintain these spaces. The master bathroom includes intricate stone surfaces that can only be scrubbed with a toothbrush; the cathedral ceilings in the living room raise the heating and cooling costs to an exorbitant sum; the chandelier in the grand entryway dangles so high that no one can replace the bulbs in it, even with a stepladder.The same fate has befallen our bodies. A body is no longer a holistic system. It is not the vehicle through which we experience joy and pleasure during our brief time in the land of the living. It is not a home to live in and be happy. It, too, is a collection of features: six pack, thigh gap, cum gutters. And these features exist not to make our lives more comfortable, but to increase the value of our assets. Our bodies are investments, which must always be optimized to bring us… what, exactly? Some vague sense of better living? Is a life without bread objectively better than a life with it? When we were children, did we dream of counting every calorie and logging every step?
When a body receives fewer calories, it must prioritize essential life support systems over any function not strictly necessary for the body’s immediate survival. Sexual desire falls into the latter category, as does high-level abstract thought. A body that restricts food and increases exercise believes it is undergoing a famine, which is not an ideal time to reproduce.Is there anything more cruelly Puritanical than enshrining a sexual ideal that leaves a person unable to enjoy sex?
Those who showed genuine interest in their partner's joys were more likely to be together.
“Throughout the day, partners would make requests for connection, what Gottman calls “bids.” For example, say that the husband is a bird enthusiast and notices a goldfinch fly across the yard. He might say to his wife, “Look at that beautiful bird outside!” He’s not just commenting on the bird here: he’s requesting a response from his wife—a sign of interest or support—hoping they’ll connect, however momentarily, over the bird.
The wife now has a choice. She can respond by either “turning toward” or “turning away” from her husband, as Gottman puts it. Though the bird-bid might seem minor and silly, it can actually reveal a lot about the health of the relationship. The husband thought the bird was important enough to bring it up in conversation and the question is whether his wife recognizes and respects that.
People who turned toward their partners in the study responded by engaging the bidder, showing interest and support in the bid. Those who didn’t—those who turned away—would not respond or respond minimally and continue doing whatever they were doing, like watching TV or reading the paper. Sometimes they would respond with overt hostility, saying something like, “Stop interrupting me, I’m reading.”
These bidding interactions had profound effects on marital well-being. Couples who had divorced after a six-year follow up had “turn-toward bids” 33 percent of the time. Only three in ten of their bids for emotional connection were met with intimacy. The couples who were still together after six years had “turn-toward bids” 87 percent of the time. Nine times out of ten, they were meeting their partner’s emotional needs.”
…
“Kindness… glues couples together. Research independent from theirs has shown that kindness (along with emotional stability) is the most important predictor of satisfaction and stability in a marriage. Kindness makes each partner feel cared for, understood, and validated—feel loved. “My bounty is as boundless as the sea,” says Shakespeare’s Juliet. “My love as deep; the more I give to thee, / The more I have, for both are infinite.” That’s how kindness works too: there’s a great deal of evidence showing the more someone receives or witnesses kindness, the more they will be kind themselves, which leads to upward spirals of love and generosity in a relationship.
There are two ways to think about kindness. You can think about it as a fixed trait: either you have it or you don’t. Or you could think of kindness as a muscle. In some people, that muscle is naturally stronger than in others, but it can grow stronger in everyone with exercise. Masters tend to think about kindness as a muscle. They know that they have to exercise it to keep it in shape. They know, in other words, that a good relationship requires sustained hard work.
“If your partner expresses a need,” explained Julie Gottman, “and you are tired, stressed, or distracted, then the generous spirit comes in when a partner makes a bid, and you still turn toward your partner.”