A herd of common aquatic springtails (Sminthurides aquaticus) in Hertfordshire, UK
by Will Atkins

Kiana Khansmith

gracie abrams
Noah Kahan
Cosmic Funnies

Jar Jar Binks Fan Club
d e v o n
taylor price
One Nice Bug Per Day

Sade Olutola

#extradirty

if i look back, i am lost
Show & Tell
Cosimo Galluzzi
Doug Jones

Origami Around

Discoholic 🪩
Monterey Bay Aquarium

Love Begins
I'd rather be in outer space 🛸
seen from Venezuela

seen from United Kingdom
seen from United Kingdom
seen from United Kingdom
seen from Spain
seen from Singapore

seen from Türkiye

seen from United Kingdom

seen from Malaysia
seen from Philippines

seen from Malaysia
seen from Malaysia
seen from Türkiye

seen from Malaysia

seen from Malaysia

seen from Germany
seen from United States

seen from United States

seen from Netherlands

seen from Türkiye
@tilderu
A herd of common aquatic springtails (Sminthurides aquaticus) in Hertfordshire, UK
by Will Atkins

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
I may be going into biofabrication but pathology will always hold a special place in my heart. So, in honor of tick season here’s some traditional art of my favorite bacteria: borrelia burgdorferi!
This is the best description I’ve heard for this method, I always thought it was bullshit because I never heard a description that actually explained how to do this other than “tap your head 20 times”.
I have anxiety-induced hissing, which sounds/feels different from sound-induced tinnitus (which I have also experience). Sound-based tinnitus actually sounds like you’re “hearing” something in your ears, whilst the hissing I have feels like it’s “inside my head”, if that makes sense. But this technique still helps!!
Here’s a visual I found because I couldn’t understand the instructions well
My ringing just went away for the first time in years. What is this blissful quiet.
wait wait i gotta try this, i don’t think i’ve had Actual Silence since i was like 5
HOW THE FUCK
Reblogging to save a life, and also because, even if you don’t have tinnitus, this is totally worth trying if you like new sensory experiences.
I don't disagree with the observation that a lot of folks in tabletop roleplaying spaces don't believe that game design is real (i.e., in the sense that they believe any GM should be able to achieve any experience of play using any system, and refuse to recognise that rules are opinionated about what sort of games they want to produce), but I feel like putting that at the forefront is confusing the symptom for the disease. A lot of folks in tabletop roleplaying spaces don't believe game design is real because they don't believe that games are real.
I've talked in the past about how Hasbro's efforts to deceptively market Dungeons & Dragons as universal entry-level game have fostered a culture of play in which any appearance that D&D isn't a universal entry-level game is regarded as evidence that you have a "bad GM", and how, in order to avoid being a "bad GM", it's necessary to treat it as a normal part of the GM's responsibilities to constantly monitor the outputs of the rules and quickly paper over any gaps between the game the rules want to produce and the game the group wants to play, like a cartoon train conductor frantically constructing the very tracks along which the train they're conducting is riding.
The trouble is that most players aren't stupid, and readily see through the act. They (correctly!) observe that the particulars of the rules don't actually seem to matter all that much, because most of the desired experience of play is the product of the GM's constant interventions, rather than the product of interpreting the outputs of the rules – but instead of identifying this as a problem, they conclude (again, quite reasonably, as they've probably never seen it done differently) that this is what tabletop roleplaying is. The GM merely pretends to be moderating a game; in truth, they're a pantomime-leader whose job is to maintain the illusion that we're playing a game with rules, when in fact what we're really doing is guided improv theatre.
And of course there's nothing wrong with guided improv theatre – it's a fine pastime, and one I've enjoyed myself on many occasions. However, it does put folks who really do want to play a game in a bind, because now there's this insurmountable communication barrier. You can say "I want to play a game, and these are the rules of that game", and receive what seems to be enthusiastic agreement with that premise; however, a significant portion of the people expressing that agreement think they're participating in a bit of kayfabe, like very dedicated professional wrestlers who stay in character even outside the ring.
Critically, nobody is necessarily acting in bad faith in this equation. The folks who don't bother to learn the rules because they think games aren't real mostly aren't fucking with you on purpose; they honestly thought they were yes-anding your improv prompt by pretending to care about the mechanics of play, and when they discover that you really do expect them to do all that fiddly dice math, from their perspective it genuinely looks like you were the one misleading them. It's just a fucked up culture of play garbling all the signals in both directions.
(Note that, while I've identified Hasbro's deceptive marketing as the ultimate source of this culture of play, indie RPGs are hardly innocent of perpetuating it. You only need cast a critical eye on the "Rule Zero" sections of many popular indie games to notice that their authors are all in on the idea that games aren't real!)
"cigarette" implies the existence of a much larger "cigar"
i recovered by the time i hit post but when i first had this thought i had genuinely forgotten cigars exist

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
90% of google search ai summaries feel like this guy leaning uncomfortably over your shoulder and pointing at stuff on your screen reading out the exact same text you're already looking at
ough
my cute mole cricket basya
look how she tries to dig in the hand... so cute
String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a
Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff
(image source)
Michigan: Report from Hell [2005] Grasshopper Manufacture - PlayStation 2
ordered a “who drink arnold palmer” t shirt for the laughs and it came printed “who drink arnorl palmer” and a sports logo on the back. which possibly makes the shirt funnier
funniest shirt alive

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Pillow Fight by Richard Scarry
telegram request!
Anonymous said:
Do you think you could reblog the Here Comes the Special Boy post?
here you go, i’ve also added the tag #here comes a special boy to the original post to make it easier to find
Freaking CONEHEAD JUST FLEW RIGHT INTO ME
Then she just wanted to sit on my arm. Okay.
I made a Pinterest board with all the Broccoli Soup fanart I could find on the internet because I love when people draw my creatures and I love to look at them :)
Explore a hand-picked collection of Pins about Broccoli Soup Fanart on Pinterest.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
lil fan of art with a bunch of educación and buenosidad because im enjoying so much reading green trees soups
@somesecretpie