is anyone still here
Misplaced Lens Cap
Not today Justin
Monterey Bay Aquarium

if i look back, i am lost
official daine visual archive
NASA

Jar Jar Binks Fan Club
RMH

Andulka
Keni

shark vs the universe
Cosimo Galluzzi
hello vonnie

PR's Tumblrdome
TMBGareOK. The Official They Might Be Giants tumblr
let's talk about Bridgerton tea, my ask is open
One Nice Bug Per Day

gracie abrams

Discoholic 🪩
seen from United States
seen from United States

seen from Bangladesh

seen from United States
seen from United States
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from Netherlands

seen from United Kingdom

seen from Japan
seen from Indonesia
@qamzee
is anyone still here

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Two trucks getting divorced :(
:(
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
fuck myer briggs fuck astrology
if you ask someone who their top 3 favorite homestuck characters were you literally know everything about them
if they dont know what homestuck is then you know theyre a normal human being

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
how he cares about blood color more than the wound
what is it with me and this guy
Miku Hatsune
If requests are open could you please draw some Condy?
chure can
I keep drawing curly sheep horns on characters and thinking to myself "these look like shrimp if I colored them pink" IDK WHY
shreemp

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
What’s a pound of flesh among friends?
can i snuggle into your chest and forget about everything for a little while?
henlo
I’ve been less active but i liiiive

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
you heard her fellas
So today I learned that it is technically possible for a person in the US to order insulin online from Canada without a prescription.
And that it costs less than the copays/deductibles that many US insurance policies will charge along the way to getting insulin here in the US. And I realized this requires a PSA.
Because this is technically illegal to do. You might be easily misled into thinking that it is legal because:
US customs only rarely rejects such shipments,
as far as I know the US has never prosecuted a person for ordering quantities that are reasonable for a couple months of personal use,
Canada does not have any laws making it illegal for their pharmacies to ship insulin to US patients,
Canada does not require a prescription at all for insulin,
Canada often gets their insulin from the same factories that the US does, literally often the same exact drugs, and with comparable standards of quality and safeguards and regulations,
Canadian pharmacies consider shipping to US customers a significant part of their business model, so much so that they have payed for quite a lot of advertising to US customers through Google, and
some US citizens and residents already choose to get their insulin from Canada that way.
Wow, just look at all those reasons why you might mistakenly think it is legal - it is affordable, legal and widely accepted on Canada's side, and the insulin comes from legit sources. But to reiterate it is definitely illegal.
So you should absolutely never do it, no matter how much you might need insulin to not die.
No obligation, but if you could help spread the word of how this seemingly innocent method of getting insulin is actually illegal, you'd be doing a great service to the people who medically need insulin.
Otherwise, in a moment of desperation when they cannot afford it or their prescription for it cannot be renewed in time, they might make the wrong decision and buy insulin this illegal way, and that would be bad.
Can't break the law now can we 😉