I’m CACKLING

Jar Jar Binks Fan Club
todays bird
Doug Jones

blake kathryn
Interview Vampire Daily
ojovivo

roma★

PR's Tumblrdome

#extradirty
Sweet Seals For You, Always
Mike Driver
Misplaced Lens Cap

titsay

Kiana Khansmith
🩵 avery cochrane 🩵
Show & Tell
d e v o n
"I'm Dorothy Gale from Kansas"
The Stonewall Inn
Cosimo Galluzzi

seen from Italy
seen from Azerbaijan
seen from Chile
seen from Australia
seen from Bangladesh

seen from Pakistan

seen from Türkiye
seen from United States

seen from Netherlands
seen from France
seen from United States
seen from Türkiye

seen from Bangladesh

seen from United States

seen from Uzbekistan
seen from United States

seen from United States
seen from Ireland
seen from United Kingdom

seen from United Kingdom
@leopardinacage
I’m CACKLING

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
mamma
The Caribbean Sea emits low-frequency waves that are can be detected from space.

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Me camping
I know what i’ll be learning this weekend…
Ride of the Valkyries on Three Melodicas The Fabulous Bäckström Brothers.
it seems like today isn’t your time to shine friend
😍I love this recording of babbino caro
Ballet dancers appear in a love scene from Phedre by Jean Cocteau in Paris, 1952.Photograph by Justin Locke, National Geographic Creative
Angela Lansbury

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Pearl Bailey, Hello Dolly!
I thought it was terrifically funny. Beethoven was a lesbian—let’s twist this thing around! If we’re out of the camp, then let’s turn it around. I mean, who’s going to prove that he wasn’t?
Pauline Oliveros, Composer (via hanrahanrahan)
Love this.
(via leopardinacage)
Hi, my name is Beethoven-bot 2167
I am here to compose my daily masterpiece beep boop V I V I V I VVVVVVVVIIIIIIIII
Another groundbreaking Beethoven piano sonata recording!!!!!
the human genome. chromosome one (excerpt): GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCA
more info here: http://joerg.piringer.net/codepoetry
I love Bach’s early work!

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Teaching my kitten to play the keyboard!
fuckin idiot came in too early
A masterpiece of baroque keyboard playing, performed by true masters. #art
Rather than protecting music as a sublimely meaningless activity that has managed to escape social signification, I insist on treating it as a medium that participates in social formation by influencing the ways we perceive our feelings, our bodies, our desires, our very subjectivities—even if it does so surreptitiously, without most of us knowing how. It is too important a cultural force to be shrouded by mystified notions of Romantic transcendence.
Susan McClary from “Constructions of Subjectivity in Schubert’s Music” (via leopardinacage)
Loving that tag, Jon!
(via leopardinacage)