whose dumb ass idiot fuck idea was it to make medicine cost money
go to triple hell

Kiana Khansmith
macklin celebrini has autism
Fai_Ryy
PUT YOUR BEARD IN MY MOUTH
almost home

@theartofmadeline
art blog(derogatory)
Sweet Seals For You, Always
Sade Olutola

ellievsbear
official daine visual archive
RMH
π©΅ avery cochrane π©΅
tumblr dot com

Xuebing Du

seen from Ireland
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States

seen from United States

seen from United States

seen from United States
seen from United States
seen from South Korea
seen from Jordan
seen from United Kingdom

seen from United States
@eeveemaster547
whose dumb ass idiot fuck idea was it to make medicine cost money
go to triple hell

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch β’ No registration required β’ HD streaming
String identified: a ta t a ag g. a ttc t ta cat a. c tg Tat ta a c T Ga A gt. a a. . a.
Closest match: Lagria hirta genome assembly, chromosome: 2 Common name: Rough-Haired Lagria Beetle
(image source)
*thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs* *thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs*
*thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs* *thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs*

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch β’ No registration required β’ HD streaming
we are so back. no new developments I just have a gut feeling
new development, anything can change. everything's possible. I had a really good day today
I passed a flower shop next to a tattoo shop and at first I laughed because I thought it was ironic and then i freaked because IMAGINE YOUR OTP IN A FLORIST/TATTOO ARTIST AU
OMG I COULD TOTALLY IMAGINE THEM LIKE THAT IT WOULD BE SO PERFECT
String identified: a a t t a tatt a at t ag ca tgt t a c a t a ca AG T A T/TATT ATT A G C TTA AG T TAT T CT T ac tt!
Closest match: Hottonia palustris genome assembly, chromosome: 9 Common name: Water Violet
(image source)
the sleepy -> cozy -> asleep pipeline is very real
plushie wife who biologically doesnt need food but still wants snacks
βDonβt touch it! Thatβs the corpse of a god.β
Kagrenac, about to create one of the most mysterious events of the timeline:

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch β’ No registration required β’ HD streaming
can i feed u marbles
<- so full of marples
posture check! time to make your posture worse. it can always be worse. you can get shrimpier. inspiration if you need it:
a group of geneticists walk into a bar. t a a ga at a t a
String identified: a g gtct a t a a. t a a ga at a t a
Closest match: Vitis vinifera genome assembly, chromosome: hap1_18 Common name: Wine Grape
(image source)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch β’ No registration required β’ HD streaming
String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a
Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff
(image source)
Okay but I have to know what the actual sequence they used is closest to
"um this song is actually about masturbation!!!!!!!!" aw thats so scary :( do you wanna call your mummy (remembers how americans read that) do you wanna call your strong as fuck ice mummy
String identified: " t g acta at atat!!!!!!!!" a tat ca :( aa ca ( aca a tat) aa ca tg a c c
Closest match: Atropa bella-donna genome assembly, chromosome: 11 Common name: Deadly Nightshade
(image source)
Do you wanna call your strong as fuck poison mummy?