posture check! time to make your posture worse. it can always be worse. you can get shrimpier. inspiration if you need it:
Three Goblin Art

Janaina Medeiros
Xuebing Du
trying on a metaphor
let's talk about Bridgerton tea, my ask is open
h
he wasn't even looking at me and he found me

if i look back, i am lost
ojovivo
Sade Olutola

blake kathryn
Stranger Things
d e v o n
occasionally subtle
we're not kids anymore.
Acquired Stardust
Cosmic Funnies

â
seen from Malaysia

seen from United States
seen from Germany

seen from Netherlands
seen from United States

seen from United Kingdom

seen from Canada
seen from South Korea

seen from Germany
seen from South Korea
seen from United States
seen from Netherlands
seen from Belgium

seen from TĂŒrkiye

seen from TĂŒrkiye

seen from Germany

seen from Switzerland

seen from United Kingdom

seen from Croatia
seen from Chile
@eeveemaster547
posture check! time to make your posture worse. it can always be worse. you can get shrimpier. inspiration if you need it:

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
a group of geneticists walk into a bar. t a a ga at a t a
String identified: a g gtct a t a a. t a a ga at a t a
Closest match: Vitis vinifera genome assembly, chromosome: hap1_18 Common name: Wine Grape
(image source)
String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a
Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff
(image source)
Okay but I have to know what the actual sequence they used is closest to
"um this song is actually about masturbation!!!!!!!!" aw thats so scary :( do you wanna call your mummy (remembers how americans read that) do you wanna call your strong as fuck ice mummy
String identified: " t g acta at atat!!!!!!!!" a tat ca :( aa ca ( aca a tat) aa ca tg a c c
Closest match: Atropa bella-donna genome assembly, chromosome: 11 Common name: Deadly Nightshade
(image source)
Do you wanna call your strong as fuck poison mummy?

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
You arw a microorganism
String identified: a a cga
Closest match: You!
if you are a game designer and you force me to kill wolves AND you have them make sad puppy noises I'm killing you
see this never happens in spider solitaire for windows
Think again
String identified: a a ga g a c t A a t a a ' g t a ta T aga
Closest match: Trionyx triunguis genome assembly, chromosome: 20 Common name: African Softshell Turtle
(image source)
i'm sure other people use BLAST but when the site's down i like to imagine they're targeting you specifically
the NIH made BLAST for me to play with i just let all the scientists use it because i'm nice
ok everyone time to start laying eggs
time to start laying eggs, frightening ghoul
this is how blogging can have a huge impact on the lives of people and ghouls
*flies past*
* á¶ ËĄá¶Šá”Ëą á”á”Ëąá”*
is it really possible for a girl to eat a burger....
ourger -> đ
String identified: t a a g t at a gâŠ. ag at t a t cg c t' t a cct t a t c tat at a g t c t t t at a at a ct t atg cat t a g -> đ
Closest match: Anthopleura xanthogrammica genome assembly, chromosome: 4 Common name: Giant Green Sea Anemone
(image source)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
all of the numbers that are divisible by 17 sound so absurd. 51? 68? 85? ridiculous. 102? absolutely not. and don't even get me started on 119
34 and 136 i can believe, but i feel like i shouldnât. itâs 102 in a trench coat
did we just run out of posts to make
no, i haven't made a post about every number yet
I'm sorry to let you know that 100,000,001 (one hundred million and one) is divisible by 17 and because of that, so is every 16-digit number that is four digits repeated four times e.g. 1234123412341234
But 100,000,001 very much isn't divisible by 17
as a pink lover. The ""universal""" hatred of the color pink by young girls is due to the heavy expectation of femininity forced on them. It is an expression of frustration at gender roles. It is not internalized misogyny. No you will not inevitably start liking pink as an adult and if you do that is not healing your inner divine feminine or whatever we're saying now. Its a color. đđ
here's my cat for your dash btw. if you even care
I care very much
Oh so when Clifford the Big Red Dog grows to enormous size you love and accept him, but when I, Fenrir
odin is like âwhen thor was born the sun shone bright upon his beautiful face. i found loki on the sidewalk outside a taco bellâ
Oðinn spake:
Bright the sun shone | at the time of Ăorâs birth, And bathed his count'nance fair. Loki, wolf-father, | the trickster, the liar, I found on the cold pavement While returning in glory | from a grand hunt For a 3 AM quesadilla.
@damn-fuck-i-burnt-myself-again
I need this framed on my wall itâs so beautiful.Â
@theshitpostcalligrapher
ay @systlin hmu
@systlin
My husband complained that this was more Shakespeare than Eddas, and I challenged him to do better.
Solen sken, skönt gyllene
Dagen Tor föddes
PĂ„ trottoaren, vid Taco Bell
DÀr lÄg Loke
âKJN
My translation:
The sun shone, sweet golden
The day of Torâs birth
On the tarmac, by Taco Bell
There lay Loki
(For poetry reasons, Thor needs the Swedish spelling.)
@bold-sartorial-statement
ay yo show ur husbandÂ
@bold-sartorial-statement no but hang on this should be in runes:Â
(oops spot the typos)
i wanna translate this into icelandic so imma do itÂ
SĂłlin skein, björt og gullin við fÊðingu ĂĂłrs ĂĄ stĂgnum við Taco Bell Ăar lĂĄ Loki
The amount of quality going into these shitposts is amazing
This is not shitposting, this is transformative work!
And in Danish because why not:
Solen skinnede, skĂžn og gylden
PĂ„ dagen for Tors fĂždsel
PĂ„ asfalten ved Taco Bell
Dér lÄ Loke
âLEV MERE (LIVE MAS)â
*Snorts*
When Thor born
He hair shine brite
A very very
Magical site
But then I see
A bab from hell
I pik up loki
From taco bell
the rosetta stone of shitposting
@incorrectnorse-quotes
Now THIS is the best post on this hellsite

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch âą No registration required âą HD streaming
I FOUND IT THANK GOD this video is so important
This is real and here is the patent. Nonconsensual data collection is detailed in column #4 on page 17.
i fucking LOVE this dude (FLESH SIMULATOR is the name of his accounts). all of his videos are full of information and tips like this, and he always has loud industrial tone music mixed poorly over him speaking to make it impossible to create a clean AI copy of his voice.
jury-rigged. even keel. by the board. three sheets to the wind. loose cannon. son of a gun. pipe down. taken aback.