#formaerem

Size- Most Guardians are incredibly huge, even for a Kaiju. Most average around 300ft to 500ft in height or length alone, but that's just the average size range. On the extremely rare occasion a fully grown formaerem colony is involved in infusion, then it will create a planet sized Guardian.

Intelligence- When an organism becomes a Guardian, it's intelligence increases. The amount of intelligence that an organism gains upon infusion varies from individual to individual, but it’s always enough to be sapient.

Luminescence- Almost every Guardian has some kind of luminescence, with the vast majority of Guardians being at least partially bioluminescent. Some Guardian luminescence can also be multicolored or can change colors based on mood or social cues, but the majority of Guardians can't change their luminescence color.

Telepathy- Guardians can communicate via telepathically, but when they communicate their voice can be heard by other people in the area. How many people can hear the telepathic voice depends on how close someone is and how ‘loud’ the speaker decides to be. The most interesting thing, however, is the fact that there seems to be almost no language barrier. If you talked to a Guardian who speaks a different language, then the voice that you would hear would speak to you in your language.

Infinity Organ- The part of a Guardian's body where the Formaerem levels in their bodies is the highest is known as the ‘Infinity Organ’. This is actually their heart (or at least their most important heart or heart equivalent) and it contains all their power and a copy of their memories. A Guardian can regenerate their entire body from just their Infinity Organ. The only flaw is that the Infinity Organ itself cannot regenerate, and if it were to be destroyed then the Guardian would die. However, they are incredibly difficult to damage.

Multiverse Traversal- Guardians can travel and transport things between universes, although it takes a lot of energy to do. They do this by focusing on where they want to go, and then opening a hole in the time-space continuum by doing some kind of action or gesture. These ‘portals’ are visible gateways that Guardians can open and close at will (depending on how much energy they have). An interesting thing to note is that, because alternate universes can have slightly to radically different laws of physics, there are universes that only very resistant Guardians can survive in and even universes that can be deadly to Guardians.

Super Strength- The average Guardian can lift twice their own body weight with ease and are able to move around unhindered by G-forces close to 300g. Some aren't as powerful while others are vastly more powerful than this.

G-force Resistance- This ties into Guardian super strength. As already stated, the average Guardian can withstand 300g without breaking a sweat, but eventually within a somewhat short period of time even they will succumb to the amazing power of gravity (this is why they have their own gravitational fields). Some Guardians are more G-force resistant than normal and some are less resistant. If a normal Guardian were to spend a day on earth without their personal gravitational field on, then they would become exhausted within an hour; think of it as walking nonstop for 24 hours.

Lightning Reflexes- Any conventional organism that is the same size as a Guardian would have an extremely delayed response to external stimuli. It would take several minutes or even hours for a brain signal to travel through the entire body. But Guardians, on the other hand, do not face this problem thanks to the space warping properties of formaerem.

Super Speed- Despite being hundreds of feet tall, Guardians are capable of moving at speeds that only the fastest of human aircraft can compare to. To the Guardian it feels like they aren’t even remotely giant and that they are moving at a normal speed for something that is, in reality, thousands of times smaller than them. Under normal circumstances this would lead to destructive events like their footsteps having the same force of an H-bomb. Fortunately this usually isn’t the case since the gravity that they manipulate around them helps lesson the force they generate by a large margin.

Dull To Pain- A Guardian's body is dull to large amounts of pain. Stubbing a toe is ironically more painful than losing a limb to them.

Regeneration- Every Guardian can regenerate. It doesn't matter what was damaged; as long as the Infinity Organ is safe then they can regenerate after a wound is inflicted. While this alone is quite impressive, Guardians are capable of faster and more rapid regeneration. Guardian regeneration is much like breathing for humans. You can consciously breathe, but your body usually unconsciously does it for you (haha you’re thinking about it). A Guardian can slowly regenerate, but they can exponentially speed up the process by focusing. Focusing on the wound can dramatically shorten the time spent regenerating things like limbs from a minute to seconds. How fast a Guardian can regenerate varies from Guardian to Guardian, and things like cauterized wounds or acid covered wounds take a little longer to heal, but because of their regenerative powers, Guardians are more or less immortal and they usually tend to not age all that much (Guardians are unable to die of old age).

Basic Instinct- When an organism infuses with Formaerem and becomes a Guardian they get many powers and abilities as a result of this symbiosis. Upon waking, a Guardian is instantly aware of these abilities and how to properly use them. Effectively eliminating the need to train and hone these abilities.

Respiration- Guardians don't need to breathe to survive and can switch to an anaerobic metabolism, although this isn’t very comfortable and can quickly use up energy. To prevent this, their lungs (if they have any) are designed to be able to take in many types of gasses without harm.

Self Sustaining- Guardian Kaiju can self sustain themselves in order to provide their body with energy. The exact way they do this varies depending on the individual. Some do this chemically while others are high energy reactors, and there are even a few with an anatomy that works like a nuclear or even fusion reactor. Their ability to produce more energy than they normally use lets Guardians stockpile on energy. This is partly due to the fact that Formaerem directly draws power from across the Multiverse itself. Of course, when in combat Guardians use up vast amounts of energy, and this is why they still feel the need to occasionally ‘eat’. Most Guardians in the guardian society don’t ever fight though, unless it’s for entertainment. It can often seem like they have more energy than their body can hold, but this is because formaerem stores some of their energy outside space-time. If a guardian ever does run out of energy, they enter an “energy coma” where they are unconscious and slow metabolic activity to a crawl while their Formaerem recharges them enough to wake up.

Diet- While Guardians are capable of self-sustaining themselves, they still need to harness other energy sources to provide fuel for their powers and abilities in combat, which use a lot of energy. Guardians can feed off of other organisms, photosynthesize (in some cases), consume minerals and raw materials, and filter particles and ions. They can basically eat everything.

Personal Gravitational Field- Guardians are able to support most of their weight with their own personal full body gravity bubble. Or rather two bubbles (also they aren’t technically ‘bubbles’ and are actually warped to the shape of the Guardian). These two types of artificial gravity bubbles are called the Internal Gravitational Field and the External Gravitational Field. The Internal Gravitational Field is used to support the body and strengthen certain parts. The External Gravitational Field, on the other hand, is used to negate much of the damage received from falling and help the guardian not be crushed by their own weight, and the gravitational strength can vary between individual Guardians. The External Gravitational Field is also partially how Guardians are able to move so fast. Their External Gravitational Field helps pull individual body parts as they move by making the gravitational pull stronger in certain areas in order to accelerate their body in a direction, at Xm/s^2, where X is the measure of the Guardian’s individual maximum external gravity. External gravity, if greater than the planet’s gravity, can be used to fly. A Guardian’s External and Internal Gravitational Fields are passive, and happen without any conscious thought coming from the Guardian. However, Guardians can train themselves to be able to consciously manipulate their External Gravitational Field in order to make themselves faster and more agile, as well as pull off impressive acrobatic feats. This is an incredibly hard thing to do however.

_______ bonus info______

Offspring- It's extremely hard, if not nearly impossible for a guardian to get pregnant/gravid/etc. If they do get pregnant/gravid/etc then the embryo receives a healthy supply of Formaerem before birth from the mother/yolk sack/whatever. The children can resemble their parents but, because Formaerem contains the genetic code of everything in the Multiverse, there's a chance that the offspring could bear no resemblance to their parents. However, there are guardians with powerful enough genetics that some of their traits are guaranteed to be passed onto offspring.

Taxonomy- When an organism infuses with Formaerem to become Guardian Kaiju, they will most likely become a completely different organism (however, some traits can be carried over from the pre-Guardian form and there are some cases where the Guardian ended up bearing a strong resemblance to their pre-Guardian form). Formaerem contains the genetic code of everything that has and will exist, and when something infuses with it then weird things happen. Certain gene sequences are swapped out for other organism's genetic code. What usually comes out as a result is a completely different organism than what went in. Very rarely are two Guardians the same genus as each other. Even more rarely are two or more Guardians the same species. What's really confusing is that, despite their different genetics and even biochemistry, they can reproduce to make fertile offspring. The offspring's genetics can be a combination of their parent's genetics, roughly the same as only one parent, or mostly different from both parents. This has confused and baffled even the best scientists and it seems likely that we wouldn't be learning how this exactly works anytime soon.

No magic- Due to the nature of formaerem, only natural materials are used during infusion, and formaerem can’t use magic to make a guardian or power it. This also means that intangible supernatural stuff does nothing to a guardian, effectively making them magic proof. Another thing to note is that guardians don’t have souls and if something had a soul before becoming a guardian, it is destroyed during infusion.

Spoilers for how formaerem and guardians impact the multiverse (which is of course in dna)

There Can Only Be One- TGTCTCTCACTAAGCTGATGTACACTATAGCGTCTGCTCGTCAGCCTGCTCGCTGATTGACTATGAAGCATGCTGTAGCGTAGCGCTTGTCACACAACTCTACACCTAACAAGCACTATCATCAGCTGTTAGCGTCTACACAGCACTATCTAGCTACACCTCACTTAGCTAAGCGATCTCCTGGTACTACACTGACTAAGCCTGCTCTCAACTCACCTCACTTAGCTGTGTCTCTGAAGCTGTGCTAGCCTGTAGAGCTCACTAACTTGACTAAGCTAGTGTAGCCTAAGTCTGTGATAGACGAGCTAGCGTCTAGACAGCTACCTGTGAACTGAGGAGCTAACTCACAGCATGCTGTAGCGTTGTGATTAGAGCACTAGCTAGCACACTTCACTAAGCACTCTCTACAGCCTAGTACTACTCAGCACTATCATCAGCCTAGTACTGTACCTACTCTCACTAAGCTAGCGTACTTAGAGCGAGTGTCTGCTCTAGTGAAGCTAGTGTAGCTAGCGTCTACTGCACAGCCTAAGTCTGTGATAGCTACTCTCACTAAGCGTAACTCTCCTGTGACGTCTATGAACGAGCTAGCGTCTGTGAAGCCTAGTACTACTCTAGAGCGATTGAGATACTATCATCGACAGCTACTGTCTATGACTCTAGAGCCTAGTACTACTCAGCACTGCTGCTCTATCATAGAGCTAGCGTCTACTGCACAGCTAGCTGACACTAATCCTGCTCCTATGAAGCCTGTAGTGAAGCATCCTGTCGCTAAGCTAGCGTCTACTGCACAGCACTATCTAGCTACACCTCACTTAGCTAAGCGATCTCCTGGTACTACACTGACTAAGCTCATGTGATCTCTAGCTACACGAGACTCACTAGTGAAGCCTCCTAGTACTACACAGCCTAAGTCTGTGATAGCTATACAGCCTGCTCAGCTAGCGTCTAAGCGCTCTGCACTGATAGAGCGAGATCACTTCACTAACGAGCACTCTCTGTTAGCGTCTACACAGCTAGCGTCTGCTCGTCAGCTAGTGTAGCCTCTGTTAGCTAAGCCTGTGAAGCTAGCGTACTTAGAGCCTGGCTAGCACTAGCGTCGATACTCACTACCTGACTCTCAGCTACTGTCTATGAAGCTGATGTACACTATAGCGTCTGCTCGTCAGCCTGCTCAGCTGTCTCCTAAGCGATCTCCTGGTACTACACTGACTAAGCTAGCGTCTACTCAGCCTGTAGAGCTACTGTCTATGACTCTAGAGCTCACACCTAACTTAGCTAAGCACTCTCAGCACTATCTAGCTACACCTCACTTAGCTAAGCGATCTCCTGGTACTACACTGACTAAGCATGCGTCTACACCTAAGCTAGCGTCTAGACAGCTACCTGTACAGCTGATGTACACTATAGCGTCTGCTCGTCAGCCTAATCTGACTAAGCTGTCACAGCTACCTGTACCTCTAGAGCTACTGTAGCTGATGTACACTATAGCGTCTGCTCGTCAGCACTTAGAGCACTATCATCACGAGCTAGCGTCTAAGCACTGCTGCTCTATCATAGAGCCTGTGACTCTAGAGCGCTGATATCATCGACAGCGATCTCTACCTACACTGATAGTGTTGTTACAGCGACCTATAGACG

Another spoiler

Meltdown- TACGATCACCTGCTCGTCAGCCTAAGTTAGCACCTAACACTAAGCCTAACATGTTAGCTGTGTCTCACTATCAGCTACCTGTGATAGCACCTATGATGAAGCGTACTACACGACAGCCATACTTACAGCGAGACTCTCCTGTCAAGCACTTAGTAGACTTCATCGTGAAGCTGTCACAGCACTTGATAGCACTGTCTCTGTACACTGTCAACTATCAGCATCCTAGTACTAATCTGAAGCTGTGCTAGCTGATAGCACCTATGATGAAGCACTAGCGTCGATACTCACTACCTGACTCTCAGCACAACTGACAGCCTAAGTGAGCTACACCTGCTACTCTCACTAAGCTGATGTACACTATAGCGTCTGCTCGTCAGCTCAACTATCATCCTATACAGCACACTAATCTAGTACTGTATGCTCACGAGCACTAGCACACTAATCTAGTACTGTATGCTCAGCCTACTCTAGACTCTGATCTGAAGCTAGCGTCTAAGCCACACTGAGCTGTACAGCGAGCACTGTTACGATTCATAGCTGTGTCTCAGCACTCTCTACAGCTAGCGTCTACTCAGCGATTGACTAAGCTGTGCTAGCACTAGCGTCGATACTCACTACCTGACTCTCTGAAGCCTACTCCTACACGTCGACAGCCACCTATGACTACACGTACTATGAAGCGATCTCTAGCTGATCAGCTAGCGTCTAGACAGCCACCTAACTTCACGTAGCACTCTCAGCCTACTCCTACACGTCGACAGCTCATGTACAACTACGAGCTAGCGTCTACTGCACAGCCATTGTTACGACAGCTAGCTAACAGAGCTACACACTTAGGATCACCTAAGCATGCTGATCATCAGCTGAGAGCTGTCGCTAAGCGATCTCTAGCTGATCAGCTAGCGTCTACTGCACAGCTGAGATCACCACTGTGATCTCTACCTGCTCGTCTGAAGCTCATGTACACATGATTGATAGAGCTGTCACAGCCTGCTCAGCTAGCGTCTAAGCTCAACTTGACTAAGCTGTGCTAGCCTGCTCTACCTGGTACTGTACGATACTATCTGAAGCATGCTGTAGCGTAGCACTATCCACCTAACTTACGACAGCCTCACTTAGGATCACACTATCATCGACAGCCGTCTGGTCCGTAGCCATTGTTACGACAGCTAGCTAACAGAGCTACACACTTAGGATCACCTATGAAGCTAGCGTCTACTGCACAGCTGAGATCACCACTGTGATCTCTACCTGCTCGTCTGAAGCATGCTGATCATCAGCACACTAATCTAGAGCACTCTCTACAGCACAACTCTCGACAGCCATTGTTACCTGATCGACAGCGCTGATCTCTCATAGCTGTGTCTCTGAAGCACTCTCTACAGCACTCATCTGATCCTGTAGCTGCTATGAAGCTCGCTGTCATCGAGCCTGCTCTAGTGTAGCTGTGTACTACACTACCACCTGGTACTAAGCTAGTGTAGCTAGCGTCTAAGCGAGTGTCTGCTCTAGAGCTGTGCTAGCACTTCATAGGATACTATCATCGACAGCTAGCTAACTCACCTGCTCGTCAGCACTAGCGTCGATACTCACTACCTGACTCTCAGCACTGAGACTCACTAGACGAGCCTGCTCTAGCTACACCTCACTATCAGCCACCTAACTTCATAGTGTCACAGCACACTAATCTAGTACTGTATGCTCAGCACTTCACTGTACAGCACTCTCTACAGCGAGCGTATCCTAGTCACAAGCGAGCACTGTTACGATTCATAGCTGTGTCTCAGCTGATGTAGCCGTCTGGTCCGTAGCCTGTAGAGCTCAACTCTCAGCGCTATCTGTTGTTACAGCTGACTAGTACTACACACTATCAGCTCACTGTAGGACAGCCATATCTGTTCATCGTGAAGCCTCCTGTAGCACTGTGTCATCGACTCACTACACCTGCTCAGCTGTGTACTACACGAGCACTGTTACGATTCATAGCTGTGTCTCAGCTAGCGTACTTAGAGCATCCTAACTTACTGAAGCTAGTGTAGCCTGCTCTAGCTACACCTCACTATCAGCTCATGTACACATGATTGATAGCTGTGTCTCAGCGAGCACTGTTACGATTCATAGCTGTGTCTCAGCTGTGCTAGCGAGATCACTGTCGATCTATGAAGCCTGACAGAGTGTTGATGACTGCATATCCTAAGCTAGTGTAGCTCATGTCTCTAGACTCTGCTCAGCTGTGATTAGTGACTGTACCTAAGCTGTGATTAGTGACTGTACCTAAGCTGTGCTAGCTGTCACCATCTGTAGACTATCAGCCATTGTACACATACTCACTACACACTACTCTAGAGCCTATAGTCAACGAGCACTATCATCAGCACTCACCTAAGCGAGTGTTGATGACTGCATATCCTAAGCTACCTAGAGCTACTCTACCTGCTCGTCAGCTGTCTCAGCTAGCGTCTAAGCCTGCTCTACCTGGTACTGTACGATACTATCTGAAGCACTCATCTGATCCTGTAGCTGCTATGAACGAGCACTATCATCAGCTGTGCTAGCTAGCGTCTGTGAAGCATGCTGATCATCAGCATCCTGTAGCTACACACTATCATCGACAGCACACTAATCTAGAGCCATATCTGTATGAGCGATGAGAGCACTCTCTACAGCTAGCTAACTCACAGCACTGAGACTCACTAGAGCACTAGCGTCGATACTCACTACCTGACTCTCAGCATGCGTCTGATCTGATAGAGCTAGCGTCTACTGCACAGCCACCTAGTCCTACTCCTACACACTTAGCTGTGTCTCAGCATGCTGATCATCAGCCATCTAAGCGTCCACTGTATGCTGCTCGTCAGCCATACTTCATCGAGCACTCTCTACAGCGCTCTGAGTCTGCTCGTCAGCATGTGTGATCTCTACTGAAGCACTCTCTACAGCATCCTGACACATTGAAGCTGTGCTTAGCTACTCAGCCTGCTCTCATGTCACCACCTATCATAGATCGACAGCACTCTCTACAGCTAGCGTCTACTGCACAGCACACTACTCTAGACTATCAGCTGATAGACTTAGCTAAGCTGAGAGCTGCACACTATCTGAAGCTGTGATTAGAGCTGTGCTAGCTCATGTCTCTAGCACTGTATCACGAGCATGCGTCTACTCAGCACTATCATCAGCTGTGCTAGCTAGCGTCTACTGCACAGCCTACTCCTACACGTCGACAGCCGTACTTGAAGCCATCTACTACTCAGCCTAAGTGAGCTACTCTACCTATACAGCACTCTCTACAGCTAGCGTCTAGACAGCCACCTAACTTCACGTAGCACTCTCAGCCTACTCCTACACGTCGACAGCTCATGTACAACTAGCTGTCTCATCGACAGCTAGCGTCTACTGCACAGCCTGCTCGCTCTGCTCCTGTAGGACAGCTGTCACGTCACTCTCAGCATGCTGATCATCAGCCATCTAAGCATGCGTACTTAGAGCCACCTAACAACTCTGCTCTGAAGCCTGCTCAGCACTAGCGAGCTGATCCTAAGCTGTGCTAGCTGAACATGTATCTACCTACACCTGCTCGTCAGCACTTGACGTAGCACTCTCTACAGCTGAATCGATTGACGTACGAGC

When an organism becomes a Guardian it goes through a process called “Formaerem Infusion” where it enters a symbiosis with Formaerem. What happens is Formaerem cells enter or come in contact the cells/body of an organism (or in many cases a complex organic compound) and insert their genetic code into the organism’s nucleus or nucleus equivalent. Genes are swapped out and the organism has their genetic code and their entire body changed in the course of a few minutes. The organism also grows incredibly gigantic. Once the bonding is over, the organism and Formaerem are officially in a symbiosis. The heart is grown and/or changed into something called an Infinity Organ, and it is in charge of making more Formaerem, keeping a copy of a guardian’s memories, as well as being a heart. Formaerem levels are also highest in the Infinity Organ. Any Formaerem that is already in a symbiosis will die if separated from their host’s Infinity Organ (for instance the Formaerem in a severed limb will die because the limb has been cut off from the body and thus is separated from the Infinity Organ). Formaerem also gives its host the genetic information to create its own gut microbes and mitochondria/chloroplasts equivalents.

The energy required for infusion is enormous and its effect on the environment is catastrophic. Starting the infusion is like setting off hundreds of hydrogen bombs and it even creates a relativistic jet, as the Formaerem and the organism suck in all available nutrients and elements in the vicinity. Infusion is so powerful that it counts as a cataclysmic extinction level event.

To get a sense of how powerful the process of infusion is, here is a run-down of what would happen if infusion were to take place on Earth. Rocks and metal beams would burst as they are used for body building materials. All organisms on the planet would be robbed of vital vitamins and minerals. Human eardrums would burst from the massive pressure differentials formed by huge volumes of the local atmosphere immediately collapsing. A giant crater would be burned into the ground. All rejected elements would fly out in all directions at high fractions of the speed of light, ionizing nearby atoms and sending gama radiation and debris flying across the globe. The shower of radioactive garbage would send dust into what remains of the atmosphere, blocking out the sun for a few months to several years.

Because of how destructive formaerem can be, the guardian society immediately initiates containment procedures to secure and lock away any formaerem they come across for the sake of the entire multiverse.

The Formaerem grant their host many powers and the ability to travel to alternate universes, and on the incredibly rare occasion a fully grown formaerem colony goes through infusion then it will create a planet sized guardian.

——————————

Alright so that’s formaerem down. Not entirely satisfied with the art but it works.

Some more stuff will be revealed about formaerem when I get around to guardians themselves, but even then there is a few more surprising secrets.

There is also other things in this that probably catch attention as well.

Here’s some extra spoilery details… if you can decode it

CTGTAGAGCTGACGTTGTGATATCTACAGCCATCTAAGCCTCTGTTAGCTATACAGCCGTTGTATGCTAGTACTACACAGCTAGCGTACTTAGAGCTAGCGTCTAAGCCTGCTCGCTGATTGACTGTGTCTCAGCGAGCACTGTTCACTATGATGAAGCTCAACTCTCAGCACTTCATAGGATACTATCATCGACAGCCATCTAAGCTCATGTCTCTAGACTCTGCTCCTATACAGCCATGACAGCGAGATCACTTCACTGCTCGTCAGCACTAGCGTCCTGGTCACTCTCTAGCTGTCAAGCTACTGTACACTAAGCACAACTTACCTAAGCTGTGCTAGCTGAGATGAGCTACACAGCCGTCTAACTGTAGACAGCACACTATAGACTATCTGAAGCACTCTCTACAGCACACTGCACCACTGTCACTGAAGCTGTGTACTACACAGCCTGTAGACGAGCTGTCACAGCGACTGTGATAGCTCATGTGATATCTACAGCTGCGATTGATAGAGCCGTACTGTACTAAGCTAGCGTCTAAGCGAGCACTGTTCACTATGATGAAGCTAGACTTCGCTAAGCGAGATCACTTCACTAAGCCTGCTCAGCTGAGAGACTTCACTAACGAGCTAGCGTCTAAGCGAGCACTGTTCACTATGATGAAGCCTGTGAAGCCTGCTCTCACACCTATACCTGCATATCGACAGCATGACTTGATAGCTAGCTGATATCAGCTGTGCTAGCACAACTTAGCTACACCTGACTATCTGAAGCACTCTCTACAGCTCATGTCTCTAGACTCTGCTCCTGCTCGTCAGCTGTCACAGCCTGTGATGTATCACTTAGCTGCTCGTCAGCCTGTAGAGCATGCTGATCATCAGCGCTTGTCACTCACTAAGCTAGCGTCTAAGCGCTTGTCACACAACTCTACACCTAACAAGCTAGTGTAGCGATTGACTAAGCCTACTCCTACACGTCGACAGCGCTCACTGTACAAGCTAGCGTCTAAGCACAGATATCTAGCTGGTACTACACTGACTAAGCTAGTGTAGCTCATGTACAGAGATCCTATAGCTAAGCCTGTAGACG