I want to take you home!
NASA

PR's Tumblrdome
noise dept.
The Bowery Presents
🪼
Lint Roller? I Barely Know Her
untitled
I'd rather be in outer space 🛸
PUT YOUR BEARD IN MY MOUTH
taylor price
Monterey Bay Aquarium

★
Mike Driver
TVSTRANGERTHINGS


Product Placement

bliss lane

titsay
trying on a metaphor
seen from United States
seen from Uruguay

seen from Canada

seen from Peru
seen from United States

seen from Malaysia
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from United States

seen from United States
seen from United States

seen from United States

seen from United States

seen from United States
seen from Chile

seen from Italy

seen from United Kingdom
@soulqem
I want to take you home!

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
by mizunon
Mid-Century Snoopy & Woodstock Valentines (x)(x) (x)(x) (x)(x)
seymour chwast
baby animals

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Split in the Tracks
Atlas and the Hesperides, 1925, John Singer Sargent
Medium: oil,canvas
ROBOCOP (1987)
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
had a dream i used a celtic harp as a bow
cat stamps // $5.50
bowtie raichu!
하이레츠~!

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
woman in a victorian novel: *develops a fever from worrying too much*
me, shivering and sweating with stress-induced anxiety: wtf that’s so unrealistic lol
screaming at self to paint the fucking deer already
Here’s the fucking deer.
I scanned the fucking deer. I might post him properly on my art account, but here he is clearer for anyone that wanted to see.