trying on a metaphor

blake kathryn
DEAR READER
Three Goblin Art

if i look back, i am lost

@theartofmadeline
todays bird
noise dept.
wallacepolsom
PUT YOUR BEARD IN MY MOUTH

#extradirty

shark vs the universe
d e v o n

Janaina Medeiros
Lint Roller? I Barely Know Her
taylor price
almost home
Xuebing Du

seen from Netherlands

seen from Australia
seen from Argentina

seen from Malaysia

seen from Germany

seen from Italy

seen from Malaysia
seen from Malaysia
seen from Belarus

seen from Malaysia
seen from Belarus
seen from Belarus
seen from United States

seen from United States
seen from United States
seen from United States
seen from Malaysia

seen from United Kingdom
seen from Malaysia

seen from Australia
@aliendna

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Porn blogs still posting porn until December 17th is the equivalent of the band playing while the Titanic was sinking.
titanic: sinking band: playing tits: out (for now)
my little sister just found out at school that you can create a religion and wants me to help her turn Halloween into a year long religion. And i never knew i wanted this until now. We will be the Halloween Cult. I am so ready for this.
My sister came up with some cult rules.
Do not deny the spooky.
Be nice to children.
Don’t be pressuring others into the religion, if they don’t want to hear leave them alone.
Every second Wednesday of each month is Pumpkin Worship, that is when you eat pumpkin flavored things, carve pumpkins, or burn pumpkin spice scented candles. Just embrace the pumpkin.
Don’t be mean to other people for reasons they can’t control, but hey if they are doing it on purpose just to annoy you, destroy them.
No touch other people if they don’t want you to, this includes hair.
Halloween is a holy day, embrace it and become one with the spooky.
Costumes are an everyday thing, but sometimes it can be inappropriate, be aware of when to embrace the spooky and when to just be a little spooky.
Don’t let anyone tell you you can’t be spooky, and if they do tell you then they don’t know what they’re talking about. You can be all the spooky all you want.
Be nice to animals.
Be ready to help others when you can but still remember that you need to put your needs first.
You are spooky, you are amazing, you are fabulous. Say it.
idk but i think we need more, go ask you internet nerd friends.
can yall think of anything else?
OKay i asked her how one would join the cult and she said to light a jack-o-lantern on a full moon then yodel into the night for the pumpkin king and if he approves you, you will hear someone yell “stut the fuck up” then you are part of the cult.
have fun yodeling my friends
person: why are you drinking coffee, don’t you have anxiety?? won’t that make it worse??
me:
Female presenting nipple

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
My tablet’s still busted, but I wanted to do somethin cute for Halloween
Click to see what these silly ghosts are up to~
This is advanced
truth coming out of her well to shame mankind (tumblr safe version)
Some people just be filler episodes

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
maybe if john green hadnt talked about cock being one of his favorite tastes we wouldn’t be in this big mess 🙄
lgbt checklist
non professional haircuts
inappropriate foot ware
shirt way 2 small or way 2 big
had to at one point prepare for a possible future where their family and friends were no longer a support system
public transit
substance abuse
intimacy issues exacerbated by endangering your life by public displays of affection
fuck cops
bad memory
utility related comfort item (The Jacket, The Backpack etc)
violently hating your body as a teen but realizing it’s other people’s perceptions and expectations of it that you hate in your adult life
never fucking going to the doctor
UTIs
everyone in ur friend group has tried to kill themselves
maturity at a young age
flannel
all of u are so surprised that every one of these r applicable….i can tell you exactly why each of them is a universal experience but i bet u can unpack this on ur own….think abt it
tonight’s episode: THE WRITER’S BARELY-DISGUISED FETISH
give 1 good example of a fetish in that show!
i can name a few
harrison ford’s fine ass nipples are too much for this site tho
Literally reblogging this for my boyfriend.
literally reblogging this as a public service

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
finally!