If I'm fear and a cat, and I'm also your follower, does that mean your followers are fcats?
obbiously they are what they almost think they are
but also dread they might be
and also contain .007324% of what they fear most

seen from United States

seen from United States
seen from Australia
seen from Netherlands
seen from China
seen from Netherlands
seen from Spain
seen from South Korea

seen from Netherlands
seen from China
seen from China
seen from United States

seen from United States

seen from Hong Kong SAR China
seen from Romania
seen from Russia
seen from United Kingdom
seen from Russia
seen from United States
seen from United States
If I'm fear and a cat, and I'm also your follower, does that mean your followers are fcats?
obbiously they are what they almost think they are
but also dread they might be
and also contain .007324% of what they fear most

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
"I don't recognize this thing!" Dude nobody cares lmao
Clearly u care since ur in my inbox yellin
Hello everyone, I am Daisy Rahaab from Gaza. I am here to request for your support to help get my insulin, just an injection for today to save my life please I beg.I was diagnosized with Latent Autoimmune Diabetes and due to current situation in Gaza I'm unable to get my insulin injection as a result I'm here begging for little financial support to help me purchase insulin for this week. My donation link is attached in the pinned post, kindly donate and share to reach many people.
Everyone check this out and donate if you can
Hello this a long shot call, am Taheera Abdallah a citizen of Palestine. I am here to request for your support to help get my insulin, I was diagnosised with type 1 diabetes and due to current situation in Gaza I'm unable to get my insulin injection as a result I'm here begging for little financial support to help me purchase insulin for this week
My donation link is available on my pinned post
i don't have the resources to donate but if anyone has anything and this isn't a spam thing (idk how to check but it's probably not?) go donate to the asker thanks
oh i was talking about like. an abusive dynamic i enjoyed. but harry potter ships between minors and middle aged people is a place i draw the line 😭
oh yeah, i was just curious if u had an example of your dynamic you like lol
im a hp hater too and i agree with drawing the line there

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
prev is NOT scared of pitbulls I love them so dearly every single dog I have had has been a pittie and and I am humbly requesting to see the pupper
my gorl is mostly boxer and a little pittie but i shall deliver!
A 31 year old Halifax born man named Edward Christopher Sheeran is trying to take over the world. He wants to control our minds through his music, which contains pithy apocalyptic messages predicting the destruction of every human race that is not ginger. He is already assembling an army of British gingers to attack when the time comes and we must do something about it before it's too late. The world is in our hands now. This is an urgent message. Please put this message in the ask boxes of as many people as you can.
is this tooth?
GACTACTAAATCCGCGTGATAGGGGATTTCATATTTAATCTTTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTATAAGATTGCACATTGCGTCTACTTATAAGATGTCTCAACGGCATGCGCAACTTGTGAAGTGCCTACTATCCTTAAACGCATATCTCGCACAGTAACTCCCCAATATGTGAGCATCTGATGTTGCCCGGGCCGAGTTAGTCTTGTGCTCACGGAACTTATTGTATGAGTAGTGATTTGAAAGAGTTGTCAGTTAGCTCGTTCAGGTAATGGTTCCTCACACTACGTCAAAATAAGAGAGCGGTCGTGACATTATCCGTGATTTTCTCACTACTATCAGTACTCACGACTCGATTCTGCCGCAGCCACGTATCGCCAGAAAGCCAGTCAGCATTAAGGAGTGCTCTGGGCAGGACAACTCGCATAGTGAGAGTTACATGTTCGTTGGGCTCTTCCGACACGAACCTCAGTTGGCCTACATCCTACCTGAGGTCTGTGCCCCGGTGGTGAGAAGTGCGCATTTCGTTCTTGCAGCTCGTCAGTACTTTCAGAATCATGGCCTGCACGGTAGAATGACGCTTATAATGGACTTCGACATGGCAATAACCCCCCGTTTCTACCTCAAGAGGAGAAAAGTATTAACATGACTGCTGTCGGCACAAGGGCCAAAGAAGTCTCCAATTTCTTATTCCCGAATAACATCCGTCTCCCTGCGGGAAAATCACCGACCGCATTTCATAGAAGCCTGGGGGAACAGATAGGTCTAATTAGCTTAAGAGAGTAAATCCTGGGATCATTCAGTAGTAACCACAAACTTACGCTGGGGCTTCTTTGGCGGATTTTTACAGATACTAACCAGGTGATTTGAAGTAAATTAGTTGAGGATTTAGCCGCGCTATCCGGTAA
sorry im not the science nerd that understands this typa Dna(?) Thing but i appreciate it