Michael W. Hicks
ojovivo

Discoholic 🪩
Peter Solarz

Love Begins

blake kathryn
PUT YOUR BEARD IN MY MOUTH
Lint Roller? I Barely Know Her
styofa doing anything

Kiana Khansmith

JBB: An Artblog!
Cosmic Funnies
RMH
Xuebing Du
I'd rather be in outer space 🛸

Origami Around

shark vs the universe
Mike Driver
Keni
🪼

seen from Türkiye

seen from Türkiye

seen from Türkiye

seen from France
seen from New Zealand
seen from United States
seen from Malaysia
seen from United States

seen from United States
seen from Colombia

seen from Malaysia

seen from Malaysia

seen from Malaysia

seen from United States
seen from France
seen from France
seen from United States
seen from United States
seen from Mexico
seen from Poland
@marlowmonday
Michael W. Hicks

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Paul Graham
New Europe
new photos of jupiter from the juno spacecraft | (good to know that van gogh had a say in how jupiter was designed)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
wait let me just…. pop this in real quick
just to make sure
OH THANK GOD
it doesn’t align with any known nucleotide sequence
There’s a mild, mild overlap here:
with a predicted sequence for a potential spinach mRNA. that’s okay. it’s 10 matches. we’re good. we’re safe
Thankfully, this meme is not further encoded in the genome of living organisms. we’re good. carry on.
Wiktor Jackowski (Polish, b. 1987), the flags, 2018. Oil on canvas, 65 x 80 cm.
via wiktorjackowski
Darren Almond, Reflect Within IV (2018). Acrylic on mirrored glass, edition unique. 146 x 206 x 3 cm (panels: 4 x 4). Courtesy the artist & PKM Gallery.
AIDS Memorial Quilt of the Names Project Foundation displayed on the National Mall, DC. in 1987

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
You got killer moves
Domingo Terciliano | Capoeira, 1974

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Artwork Copyright © Tyler Spangler
Buy prints here: society6.com/tylerspangler
Clara Balzary