Michael W. Hicks

todays bird

PR's Tumblrdome
Game of Thrones Daily
let's talk about Bridgerton tea, my ask is open

Kiana Khansmith

tannertan36
★

Jar Jar Binks Fan Club

titsay
Mike Driver
The Stonewall Inn
The Bowery Presents

izzy's playlists!
Misplaced Lens Cap
2025 on Tumblr: Trends That Defined the Year
noise dept.

$LAYYYTER
Claire Keane

seen from United Kingdom
seen from Algeria

seen from Türkiye
seen from United Kingdom

seen from Greece
seen from Australia
seen from United Kingdom
seen from United States
seen from United States
seen from Brazil
seen from Indonesia

seen from Canada

seen from Malaysia

seen from Switzerland

seen from Brazil
seen from Canada
seen from Germany
seen from Indonesia

seen from United States
seen from Saudi Arabia
@marlowmonday
Michael W. Hicks

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Paul Graham
New Europe
new photos of jupiter from the juno spacecraft | (good to know that van gogh had a say in how jupiter was designed)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
wait let me just…. pop this in real quick
just to make sure
OH THANK GOD
it doesn’t align with any known nucleotide sequence
There’s a mild, mild overlap here:
with a predicted sequence for a potential spinach mRNA. that’s okay. it’s 10 matches. we’re good. we’re safe
Thankfully, this meme is not further encoded in the genome of living organisms. we’re good. carry on.
Wiktor Jackowski (Polish, b. 1987), the flags, 2018. Oil on canvas, 65 x 80 cm.
via wiktorjackowski
Darren Almond, Reflect Within IV (2018). Acrylic on mirrored glass, edition unique. 146 x 206 x 3 cm (panels: 4 x 4). Courtesy the artist & PKM Gallery.
AIDS Memorial Quilt of the Names Project Foundation displayed on the National Mall, DC. in 1987

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
You got killer moves
Domingo Terciliano | Capoeira, 1974

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Artwork Copyright © Tyler Spangler
Buy prints here: society6.com/tylerspangler
Clara Balzary