
★
Stranger Things
Cosmic Funnies
𓃗
Xuebing Du
Game of Thrones Daily

if i look back, i am lost
Sweet Seals For You, Always

Product Placement

PR's Tumblrdome

ellievsbear
macklin celebrini has autism
RMH
Keni
YOU ARE THE REASON
KIROKAZE
let's talk about Bridgerton tea, my ask is open

Kiana Khansmith
🩵 avery cochrane 🩵
Monterey Bay Aquarium
seen from Philippines

seen from United States

seen from Russia
seen from Chile
seen from Türkiye
seen from Iraq

seen from India
seen from Mexico
seen from Indonesia
seen from Brazil
seen from Ukraine

seen from United States

seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from United States

seen from Brazil

seen from France
@lieons

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
This shit right here.
meirl
Taurus season (C.B)(5.2.18)

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
Dormant Predators
This is why I have this. Even if they can get the lock opened they can’t push the door open. Got it at Lowes for $20.
reblog for that last bit to save a life
If you’re like me and have a large gap under your front door (someone could take a stick and just poke the leaning stick style door jam out), I recommend the Addalock. It’s small, perfect for traveling, and this lock is CRAZY. It’s so simple but the door does not move.
You can’t see it from the other side, either. It also cost about $20, and I can’t recommend it enough. Easy to travel with, too! Great for Air BnBs!
That’s why I have these on my doors. They get drilled into the side and once its flipped over the door nothing is getting it open. Not the door being unlocked nothing, I’ve unlocked the door and pulled and pushed as hard as I could and it didn’t budge. When I go on a trip this is what I use and when I’m home I leave it on too. No one is getting in here.
Okay I know that it is necessary for many but what do you do if you need medical attention and you’re not able to open the door from the inside? Can the fire department get through these at least?
Yes. The fire department can and will break down your door if necessary, it’s one of the reasons they have axes; it’s entirely possible for door frames to melt/expand/seize or otherwise become unopenable during a house fire but the door itself can be hacked down. Or the window. In rare cases, the wall. Firefighters don’t fuck around with collateral damage when lives are at stake.
Sharing for all the safety items!!
Informative. Please share!
I’m always slightly detached from myself and viewing myself in a voyeurist way so everything feels cinematic but I’m crazy and tired
How To Manipulate People Into Liking You More
Original Content From Reddit
1. Be good looking. Don’t be not good looking.
Good looking people are always well received and have a greater margin of error. Serious mistakes will still cost them, but little blunders will not cost them in the way it costs ugly people. This one is hard to control though. You can influence this by working out, good hygiene, pay for nice teeth, wear high quality clothing.
2. Remember peoples names. Use them frequently.
Remember everyones name. When you see them, use their name and smile. Everyones favorite word is their own name.
3. Touch people. Body language.
when you are talking with someone, occasionally touch their shoulder or lightly grab their arm while laughing at a joke they made. Go for high fives/brofist. Do playful pushaways (more roughly with guys). Give firm handshakes. If guy/girl, go for playful palm reading. Occasionally mirror the body language of person you are talking to (not all the time or its obvious and creepy). Do not cross your arms or put hands in your pockets when talking to someone (defensive body language). Use your hands when talking to amplify your communication. Hold eye contact 70-90% of the time. Learn to smile naturally on command and do it frequently.
4. Make people feel like they are important
When talking 1 on 1 with someone, do not get easily distracted by outside things. Stay focused. LISTEN to what they say, occasionally repeat it back to them in different words/summarize after they say their bit and then ask them a question about it. Ideally convo should be 70/30 with them being 70% talking and you 30%. Just enough on your part that it does not feel like they are being interviewed. As above, smile naturally when they tell a joke (even if its not funny).
When talking to a group of people, learn to make each person feel they are the most important person you are talking to. This is very difficulty to master (I certainly havent mastered it). It’s about utilizing eye contact, body language and engaging with those in the group that engage with you.
5. Be funny and mysterious. Learn to converse well.
When its your 30. Reveal a little about yourself but never too much. Always leave a few critical details out, leave people wanting more. Make jokes. Learn to make fun of the other person in a non-cruel and playful way. NEVER insult their taste. aka NEVER insult their favorite band/movie/artpiece/author/philosopher/scientist/politician etc.
On the subject… you do not have to avoid religion and politics. Actually I would encourage it… BUT do not be argumentative. Perhaps give a a non threatening “light” countering view (like weed legalization) and ask them to share their views and they make them think you have possibly been persuaded by them. People often do not get to talk about religion/politics and when they do someone is there to yell at them and argue with them and make them feel bad. Stand out by letting them almost persuade you. However this leads into another important point.
Do not share your views on everything. Do not be a fedora or a bible thumper. Do not be a liberal or a conservative. Give 100% support to neither side and nooone. allow them to fight for your approval but never fully give it anyone. People will respect you for being open-minded and will do good things for you while trying to win you over. Great politicans win the hearts of people by being ambigious and never being too stuck on a philosophical or political point. Be loosy goosy and mysterious.
6. Be positive.
Do not be overly positive about EVERYTHING. But generally be positive. Be fun. Be spontaneous. Be a “dancer” not a “wallflower.’ The world sucks. We get it. Everyone knows. Thats why we need some damn positivity. Stop feeling sorry for yourself. Stop imagining yourself as the victim of circumstances outside of your control. Don’t waste energy hating people. Don’t complain about anything ever. Never. Just never. Yes, its tough. But the world is 99% complainers. Find someone who doesn’t complain and you might just start a religion or cult around them. World is going to end tomorrow? Sounds like a good time to go dancing, enjoy the stars and make love.
7. Learn Skills and get good at them.
Horse-riding. Guitar. Dancing. Acrobatics. Magic. Math. Judo. Swimming. Writing. Painting. Acting. Fixing machines. Electronics.
Whatever it is, get good at it. Enjoy it. The world is full of people who just sit on facebook/reddit or watching tv or reading crappy fiction novels. Be someone who has a skill or enjoys doing something productive and people will want you in their lives, they will idolize you. You will have intrinsic worth.
8.Be Narcissistic but set your ego aside.
Do not let people insult you. If someone jokes at you, joke right back and laugh. Never be insulted. You are a god. Gods are not insulted by mortals. But do not talk about yourself, do not complain, do not have a victim complex. You are a god, you do not need approval. You are not worried about the loss of a friend or a girl who does not appreciate your godliness. But you are not rude. You are above them. This kind of attitude is hard to cultivate and maintain, but people will be drawn to you if you learn to utilize a kind of narcissism.
9. Learn to speak properly 2.
Lower the tonality of your voice at end of statements. Do not uptalk. Learn to pause between sentences, 2 seconds is good. Learn to speak a bit slower. (see Carl Sagan, Obama etc.) Do not be nervous about silences. Utilize silence.
10. Do not be a know-it-all. Make other people feel smart.
This one is tough. Learn to come off as intelligent but never try to one-up people. Do not be a know-it-all. Come off in body-language and attitude, in skills and success - come off as intelligent. But in conversation, do not always be correcting people. Do not try to constantly teach people. A wise teacher teaches by success and through kindness. Do not insult people for having differing opinions or not knowing something. Let people teach you. Remember that everyone you meet knows something(s) you don’t. Let them teach you. Be open minded. Refer to 5 though, let them enlighten you but maintain some skepticism, do not be won over too easily. People are constantly being told by other people they are stupid, stand out by making them feel smart.
11. Give specific compliments to specific people, do it rarely and only when desrved.
Another one I had to edit to add. Generic compliments like “you are beautiful” or “you are nice” or “you are a good person” or “you are smart” are given ALL the time. They mean nothing. It is very evident that you are trying to win them over, it’s lazy, and it just inflates their ego. Yes, for all the negativity in the world and people telling them they are stupid - most people have massive egos (which is why you need to learn to set aside your ego while being a narcissist. wei wu wei, bitch). Everyone has now been brought up being told they are special, the are the hero(ine) of the story, they are destined for greatness. We live in a culture of the ego-maniacal. Vague compliments only inflate this false sense of ego and make people think you are trying to get something from them.
Women and hot guys get these kinds of vague compliments daily. They essentially become a screening process on who not to talk to. Forget it.
However, specialized compliments are good for the less egotistical. The more genuine they seem or are, the better. They don't have to be genuine of course, they just need to appear genuine. “That’s a cool hat” or “wow you nailed that dance” or “how did you get a 90 on that test?” are much better.
Do not compliment people with super-egos. These people take all forms of compliments as fodder for their ego. they will toss you aside like a cheap snack bar wrapper. Learn to be different by not complimenting these people. Play hard to get. Make light jokes towards them. Treat them as an equal or lesser. These people crave that, deep down inside they often desire an equal and are tired of being treated like idols.
12. Learn to read people. get what you want by learning to give people what they want. Be the trojan horse.
Each person is different. As 11 illustrates, everyone wants something different. Learn to read people and give them what they want. Some people want to be insulted, some people want to be idolized. Some of them want to huuurt you~~ No but seriously, a good tactician changes his/her strategy to the battefield and the state of affairs. Learn to vary your approach. Give people what they want (not usually physial objects, this is metaphysical/metaphorical) and they will often willingly give you what you want.
My best example for this is anal. I used to just ask girls I was dating “Can we do anal?” and the answer is 99% no. It’s not a sexy way of going about it and its too upfront. Play the trojan horse. If you meet a girl who likes to be dominated, dominate her, and she will love anal. Meet a girl whose never orgasmed, and give her an orgasm while your finger is in her butt, and she will love anal. Meet a girl who wants to be dominant, and let her dominate - and she will love anal. This seems like just idiotic sexual advice, but it is metaphorical for a lot of things in life. You can substitute anal for a lot of things - a pay raise, a promotion, going skydiving, moving in together, getting a record deal etc. There are plenty of things in life that may seem to people a one-sided deal that will cause them pain. Rather than charging the gates and being confrontational or begging for what you want - learn to sneak in like the trojan horse. Many of these things often end up being good for both parties (I bet whoever Jay Z convinced to sign him ended up happier for it later).
END
This is just a “brief” list. If you aren’t willing to do these things, you don't really want to be liked. You only kind of want it. For further reading see:
48 laws of power
Wisdom of Psychopaths
Influecne
What every BODY is saying
How to win friends and influence people
How to talk to anyone: 92 little tricks for big success
The Charisma myth
The Art of SEDUCTION
~By HellsArchitect From Reddit via this link <view on reddit>
Reposting so I read this weekly
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
She’s like warm days, sunshine, honey and love.
i need feminism because when jesus does a magic trick it’s a goddamn miracle but when a woman does a magic trick she gets burned at the stake
fabulous
i mean they did also kill jesus. that was a pretty significant thing that happened. like i understand where you’re coming from here but they very much did kill jesus.
3 am is such a powerful time. there are people sleeping. there are people partying. there are people having a movie marathon. there are people crying. there are people loving. there are people dying. there are people living. toegther at 3 am.
don’t romanticize 3 am everyone should be in bed!!!! go to sleep bitch!!!!!

Anya is live and ready to show you everything. Watch her strip, dance, and perform exclusive shows just for you. Interact in real-time and make your fantasies come true.
Free to watch • No registration required • HD streaming
i want men to be able to emotionally connect with people they don’t plan on having sex with. i want men to stop assuming i am planning on having sex with them because i make an effort to engage with them emotionally. i want men to stop feeling personally betrayed by the fact that i engage deeply & genuinely with people regardless of whether i desire them sexually, because i value people & seek to understand & connect with them regardless of sexual attraction
He set fire to the world around him but never let a flame touch her.