i don't know what this text will return, but i'll design a piece of clothing or full outfit based on whatever organism appears from this. I felt like training fashion design some more but didn't have an idea of what to make
just to add more characters to the text, here's a brigadeiro recipe, a dessert from my country:
ingredients:
1 box of condensed milk
1 tablespoon of unsalter butter
7 tablespoons of chocolate milk powder OR 4 tablespoons of cocoa powder
sprinkles
how to make:
add the condensed milk to a big pan and cook it on medium heat until it starts to unstick from the pan. Once it starts unsticking, you take it out of the stove and let it cool down, and then you take little bits and roll them into little balls and cover the little balls in sprinkles.
String identified: tattttttgacctgttaatgaaatttagagttaaaattattacaactttttagacatctgtctaattttaccattaccataatctagaactattttatttctacttattcgtattttattcattatttattttaacttta
Closest match: Acrobasis repandana genome assembly, chromosome: 19 Common name: Beautiful Oak Knot-horn
(image source)
